Construct: shRNA TRCN0000084922
Construct Description:
- Construct Type:
- shRNA
- Other Identifiers:
- NM_023729.2-438s1c1
- DNA Barcode:
- CGGACCCAAATACTGCTTGTA
Original Target:
- Taxon:
-
Mus musculus (mouse)
- Gene:
- Asz1 (74068)
- Gene Description:
- ankyrin repeat, SAM and basic leucine zipper domain containing 1
- Transcript:
- RefSeq NM_023729.2 (NON-CURRENT)
- Match location:
- Position 438 (CDS)
Vector Information:
- Vector Backbone:
- pLKO.1
- Pol II Cassette 1:
- PGK-PuroR
- Pol II Cassette 2:
- n/a
- Pol III Promoter:
- constitutive hU6
- Pol III Insert:
- (TRCN0000084922)
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
Current transcripts matched by this shRNA:
Sequence Information
- Target Sequence:
- CGGACCCAAATACTGCTTGTA
- Hairpin Sequence:
-
5'-CCGG-CGGACCCAAATACTGCTTGTA-CTCGAG-TACAAGCAGTATTTGGGTCCG-TTTTTG-3'
Oligo design for arrayed cloning:
- Forward sequence:
- 5'-CCGGCGGACCCAAATACTGCTTGTACTCGAGTACAAGCAGTATTTGGGTCCGTTTTTG-3'
- Reverse sequence:
- 5'-AATTCAAAAACGGACCCAAATACTGCTTGTACTCGAGTACAAGCAGTATTTGGGTCCG-3'
Other clones with same target sequence:
(none)
