Construct: shRNA TRCN0000119953

Construct Description:

Construct Type:
shRNA
Other Identifiers:
NM_008921.1-1190s1c1
DNA Barcode:
GCACCGTATGTGAAAGTATTT

Original Target:

Taxon:
Mus musculus (mouse)
Gene:
Prim1 (19075)
Gene Description:
DNA primase, p49 subunit
Transcript:
RefSeq NM_008921.1 (NON-CURRENT)
Match location:
Position 1190 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000119953)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this shRNA:

Sequence Information

Target Sequence:
GCACCGTATGTGAAAGTATTT
Hairpin Sequence:
5'-CCGG-GCACCGTATGTGAAAGTATTT-CTCGAG-AAATACTTTCACATACGGTGC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCACCGTATGTGAAAGTATTTCTCGAGAAATACTTTCACATACGGTGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCACCGTATGTGAAAGTATTTCTCGAGAAATACTTTCACATACGGTGC-3'

Other clones with same target sequence:

(none)