Construct: shRNA TRCN0000127251  
  
    Construct Description:
    
      - Construct Type:
- shRNA
- Other Identifiers:
- NM_145375.1-795s1c1
- DNA Barcode:
- GCCTGGAAACATCGTAGGAAA
Original Target:
        
          - Taxon:
- 
                          Mus musculus (mouse)                      
- Gene:
- Tm6sf1 (107769)
- Gene Description:
- transmembrane 6 superfamily member 1
- Transcript:
- RefSeq NM_145375.1 (NON-CURRENT)
- Match location:
- Position 795 (CDS)
 
  
    Vector Information:
    
      - Vector Backbone:
- pLKO.1
- Pol II Cassette 1:
- PGK-PuroR
- Pol II Cassette 2:
- n/a
- Pol III Promoter:
- constitutive hU6
- Pol III Insert:
- (TRCN0000127251)
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
 
 
  Current transcripts matched by this shRNA:
  
  
      Sequence Information
    
      - Target Sequence:
- GCCTGGAAACATCGTAGGAAA
- Hairpin Sequence:
- 
        5'-CCGG-GCCTGGAAACATCGTAGGAAA-CTCGAG-TTTCCTACGATGTTTCCAGGC-TTTTTG-3'
Oligo design for arrayed cloning:
    
      - Forward sequence:
- 5'-CCGGGCCTGGAAACATCGTAGGAAACTCGAGTTTCCTACGATGTTTCCAGGCTTTTTG-3'
- Reverse sequence:
- 5'-AATTCAAAAAGCCTGGAAACATCGTAGGAAACTCGAGTTTCCTACGATGTTTCCAGGC-3'
Other clones with same target sequence:
    (none)