Construct: shRNA TRCN0000151196

Construct Description:

Construct Type:
shRNA
Other Identifiers:
NM_000946.2-1190s1c1
DNA Barcode:
GTCAAACATAGAACCAGAGAT

Original Target:

Taxon:
Homo sapiens (human)
Gene:
PRIM1 (5557)
Gene Description:
DNA primase subunit 1
Transcript:
RefSeq NM_000946.2 (NON-CURRENT)
Match location:
Position 1190 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000151196)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this shRNA:

Sequence Information

Target Sequence:
GTCAAACATAGAACCAGAGAT
Hairpin Sequence:
5'-CCGG-GTCAAACATAGAACCAGAGAT-CTCGAG-ATCTCTGGTTCTATGTTTGAC-TTTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTCAAACATAGAACCAGAGATCTCGAGATCTCTGGTTCTATGTTTGACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTCAAACATAGAACCAGAGATCTCGAGATCTCTGGTTCTATGTTTGAC-3'

Other clones with same target sequence:

  1. TRCN0000275192