Construct: shRNA TRCN0000182297
Construct Description:
- Construct Type:
- shRNA
- Other Identifiers:
- NM_025506.1-386s1c1
- DNA Barcode:
- GCTGCACACTATTTCACGGAT
Original Target:
- Taxon:
-
Mus musculus (mouse)
- Gene:
- Riiad1 (66353)
- Gene Description:
- regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
- Transcript:
- RefSeq NM_025506.1 (NON-CURRENT)
- Match location:
- Position 386 (CDS)
Vector Information:
- Vector Backbone:
- pLKO.1
- Pol II Cassette 1:
- PGK-PuroR
- Pol II Cassette 2:
- n/a
- Pol III Promoter:
- constitutive hU6
- Pol III Insert:
- (TRCN0000182297)
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
Current transcripts matched by this shRNA:
Sequence Information
- Target Sequence:
- GCTGCACACTATTTCACGGAT
- Hairpin Sequence:
-
5'-CCGG-GCTGCACACTATTTCACGGAT-CTCGAG-ATCCGTGAAATAGTGTGCAGC-TTTTTTG-3'
Oligo design for arrayed cloning:
- Forward sequence:
- 5'-CCGGGCTGCACACTATTTCACGGATCTCGAGATCCGTGAAATAGTGTGCAGCTTTTTG-3'
- Reverse sequence:
- 5'-AATTCAAAAAGCTGCACACTATTTCACGGATCTCGAGATCCGTGAAATAGTGTGCAGC-3'
Other clones with same target sequence:
(none)