Construct: shRNA TRCN0000186922

Construct Description:

Construct Type:
shRNA
Other Identifiers:
NM_146879.1-772s1c1
DNA Barcode:
GCTGCTATCTATACCTACATT

Original Target:

Taxon:
Mus musculus (mouse)
Gene:
Olfr330 (258879)
Gene Description:
olfactory receptor 330
Transcript:
RefSeq NM_146879.1 (NON-CURRENT)
Match location:
Position 772 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000186922)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this shRNA:

Sequence Information

Target Sequence:
GCTGCTATCTATACCTACATT
Hairpin Sequence:
5'-CCGG-GCTGCTATCTATACCTACATT-CTCGAG-AATGTAGGTATAGATAGCAGC-TTTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCTGCTATCTATACCTACATTCTCGAGAATGTAGGTATAGATAGCAGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCTGCTATCTATACCTACATTCTCGAGAATGTAGGTATAGATAGCAGC-3'

Other clones with same target sequence:

(none)