Construct: ORF TRCN0000465383
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017397.1_s317c1
- Derived from:
- ccsbBroadEn_15498
- DNA Barcode:
- ATGGCGATGCACTGGCCCACATGA
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MGST3 (4259)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465383
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4259 | MGST3 | microsomal glutathione S-tr... | NM_004528.4 | 99.5% | 97.3% | 306T>C;445delA |
| 2 | human | 4259 | MGST3 | microsomal glutathione S-tr... | XM_005245174.3 | 99.5% | 97.3% | 306T>C;445delA |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 522
- ORF length:
- 456
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgtcctctct aaggaatatg gttttgtgct tctaactggt gctgccagct 121 ttataatggt ggcccaccta gccatcaatg tttccaaggc ccgcaagaag tacaaagtgg 181 agtatcctat catgtacagc acggaccctg aaaatgggca catcttcaac tgcattcagc 241 gagcccacca gaacacgttg gaagtgtatc ctcccttctt attttttcta gctgttGGAG 301 GTGTTTACCA CCCGCGTATA GCTTCTGGCC TGGGCTTGGC CTGGATTGTT GGACGAGTTC 361 TTTATGCTTA CGGCTATTAC ACGGGAGAAC CCAGCAAGCG TAGTCGAGGA GCCCTGGGGT 421 CCATCGCCCT CCTGGGCTTG GTGGGCACAA CTGTGTGCTC TGCTTTCCAG CATCTTGGTT 481 GGGTTAAAAG TGGCTTGGGC AGTGGACCCA ATGCTGCCAT TACCCAACTT TCTTGTACAA 541 AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA 601 ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA 661 GGACGAATGG CGATGCACTG GCCCACATGA ACGCGTTAAG TCgacaatca acctctggat 721 tacaaaattt gtgaaagatt