Construct: ORF TRCN0000465762
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014574.1_s317c1
- Derived from:
- ccsbBroadEn_01974
- DNA Barcode:
- GCACCCCCAGGAGACCTCCGTCGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RNASET2 (8635)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465762
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8635 | RNASET2 | ribonuclease T2 | NM_003730.6 | 100% | 100% | |
| 2 | human | 8635 | RNASET2 | ribonuclease T2 | XM_017011397.1 | 85.1% | 85.1% | 0_1ins114 |
| 3 | human | 8635 | RNASET2 | ribonuclease T2 | XM_017011398.1 | 64% | 64% | 0_1ins276 |
| 4 | human | 8635 | RNASET2 | ribonuclease T2 | XM_024446575.1 | 64% | 64% | 0_1ins276 |
| 5 | human | 8635 | RNASET2 | ribonuclease T2 | XM_024446576.1 | 64% | 64% | 0_1ins276 |
| 6 | human | 8635 | RNASET2 | ribonuclease T2 | XM_017011399.1 | 63.2% | 59.1% | 446_447ins46;486_487ins236 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 834
- ORF length:
- 768
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaatag 61 ttggcatgcg ccctgcagcc ctgcgcgggg ccctgctggg ctgcctctgc ctggcgttgc 121 tttgcctggg cggtgcggac aagcgcctgc gtgacaacca tgagtggaaa aaactaatta 181 tggttcagca ctggcctgag acagtatgcg agaaaattca aaacgactgt agagaccctc 241 cggattactg gacaatacat ggactatggc ccgataaaag tgaaggatgt aatagatcgt 301 ggcccttcaa tttagaagag attaaggatc ttttgccaga aatgagggca tactggcctg 361 acgtaattca ctcgtttccc aatcgcagcc gcttctggaa gcatgagtgg gaaaagcatg 421 ggacctgcgc cgcccaggtg gatgcgctca actcccagaa gaagtacttt ggcagaagcc 481 tggaactcta cagggagctg gaccTCAACA GTGTGCTTCT AAAATTGGGG ATAAAACCAT 541 CCATCAATTA CTACCAAGTT GCAGATTTTA AAGATGCCCT TGCCAGAGTA TATGGAGTGA 601 TACCCAAAAT CCAGTGCCTT CCACCAAGCC AGGATGAGGA AGTACAGACA ATTGGTCAGA 661 TAGAACTGTG CCTCACTAAG CAAGACCAGC AGCTGCAAAA CTGCACCGAG CCGGGGGAGC 721 AGCCGTCCCC CAAGCAGGAA GTCTGGCTGG CAAATGGGGC CGCCGAGAGC CGGGGTCTGA 781 GAGTCTGTGA AGATGGCCCA GTCTTCTATC CCCCACCTAA AAAGACCAAG CATTGCCCAA 841 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 901 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 961 TATCTTGTGG AAAGGACGAG CACCCCCAGG AGACCTCCGT CGGACGCGTT AAGTCgacaa 1021 tcaacctctg gattacaaaa tttgtgaaag att