Construct: ORF TRCN0000466429
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003285.1_s317c1
- Derived from:
- ccsbBroadEn_00267
- DNA Barcode:
- GAGGTTACATCCTCATACAAACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CD79A (973)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466429
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 973 | CD79A | CD79a molecule | NM_001783.4 | 100% | 100% | |
| 2 | human | 973 | CD79A | CD79a molecule | NM_021601.4 | 83.1% | 82.7% | 265_266ins114 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 747
- ORF length:
- 678
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcctgggggt ccaggagtcc tccaagctct gcctgccacc atcttcctcc 121 tcttcctgct gtctgctgtc tacctgggcc ctgggtgcca ggccctgtgg atgcacaagg 181 tcccagcatc attgatggtg agcctggggg aagacgccca cttccaatgc ccgcacaata 241 gcagcaacaa cgccaacgtc acctggtggc gcgtcctcca tggcaactac acgtggcccc 301 ctgagttctt gggcccgggc gaggacccca atggtacgct gatcatccag aatgtgaaca 361 agagccatgg gggcatatac gtgtgccggg tccaggaggg caacgagtca taccagcagt 421 cctgcggcac ctacctccgc gtgcgccagc cgccccccag gcccttcctg gacatgggGG 481 AGGGCACCAA GAACCGAATC ATCACAGCCG AGGGGATCAT CCTCCTGTTC TGCGCGGTGG 541 TGCCTGGGAC GCTGCTGCTG TTCAGGAAAC GATGGCAGAA CGAGAAGCTC GGGTTGGATG 601 CCGGGGATGA ATATGAAGAT GAAAACCTTT ATGAAGGCCT GAACCTGGAC GACTGCTCCA 661 TGTATGAGGA CATCTCCCGG GGCCTCCAGG GCACCTACCA GGATGTGGGC AGCCTCAACA 721 TAGGAGATGT CCAGCTGGAG AAGCCGTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 781 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 841 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGAGGTTAC 901 ATCCTCATAC AAACTTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 961 aagatt