Construct: ORF TRCN0000466682
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009149.1_s317c1
- Derived from:
- ccsbBroadEn_15971
- DNA Barcode:
- GAAAAAGCTTTTAGGCTTTAGGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AEN (64782)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466682
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64782 | AEN | apoptosis enhancing nuclease | NM_022767.4 | 99.7% | 99.6% | 418A>G;642G>C |
| 2 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_005254966.1 | 99.7% | 99.6% | 418A>G;642G>C |
| 3 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_005254967.1 | 99.7% | 99.6% | 418A>G;642G>C |
| 4 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_011521905.2 | 99.7% | 99.6% | 418A>G;642G>C |
| 5 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_017022489.1 | 99.7% | 99.6% | 418A>G;642G>C |
| 6 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_006720645.3 | 75.7% | 75.6% | 418A>G;642G>C;741_742ins234 |
| 7 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_017022490.1 | 75.7% | 75.6% | 418A>G;642G>C;741_742ins234 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1041
- ORF length:
- 975
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt accccgggag gcccctgagt ctgctcagtg cctgtgccct tccctcacca 121 tcccaaatgc caaggatgtg cttcggaaga ggcacaagag aaggagccga cagcaccagc 181 ggttcatggc ccggaaggcc ttgctgcagg agcaggggct gctgagcatg cctccagaac 241 cagggtcctc cccactgccc acccctttcg gggcagcgac agcaactgaa gctgccagca 301 gtgggaagca gtgtctgagg gctggatctg gcagtgcccc atgcagcaga aggcctgctc 361 ccgggaaagc ctcagggccc ttgcccagca agtgtgtggc tatcgactgt gagatggtgg 421 gcacgggacc ccgagggcgg gtaagcgagc tggcccgctg ttccattgtg agctaccatg 481 gcgatgtcct ctatgacaag tacatcaggc ctgagatgcc catcgctgac taccgtaccc 541 gctggagtgg catcactcgg cagcacatgc gcaaggctgt ccccttccag gtggcccaga 601 aagagatcct taagctcctg aagggcaagg tggtggtggg gcacgcgctg cacaacgact 661 tccaggcgct caagtatgtc caccctcgga gccagacccg ggataccacc tatgtcccaa 721 acttccTCAG CGAGCCCGGC CTCCACACCC GGGCCCGGGT CTCTCTAAAG GACCTGGCCC 781 TGCAGCTGCT GCACAAGAAG ATCCAGGTGG GCCAGCACGG GCACTCATCA GTAGAAGATG 841 CCACGACAGC CATGGAGCTC TACCGGCTGG TGGAGGTGCA GTGGGAACAG CAGGAGGCCC 901 GCAGCCTCTG GACCTGCCCC GAGGACAGAG AACCTGACAG CAGCACAGAC ATGGAACAGT 961 ACATGGAGGA CCAGTACTGG CCCGATGACC TGGCCCACGG CAGCAGAGGA GGAGCCAGGG 1021 AGGCACAGGA CAGAAGGAAT TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1081 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1141 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGAAA AAGCTTTTAG 1201 GCTTTAGGGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt