Construct: ORF TRCN0000466829
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014139.1_s317c1
- Derived from:
- ccsbBroadEn_16161
- DNA Barcode:
- CCAGAACTCACATCATCCAGCACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GSTK1 (373156)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466829
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 373156 | GSTK1 | glutathione S-transferase k... | NM_015917.3 | 100% | 100% | |
| 2 | human | 373156 | GSTK1 | glutathione S-transferase k... | NM_001143680.1 | 94.6% | 94.6% | 383_384ins36 |
| 3 | human | 373156 | GSTK1 | glutathione S-transferase k... | NM_001143681.1 | 80.9% | 80.9% | 153_154ins129 |
| 4 | human | 373156 | GSTK1 | glutathione S-transferase k... | NM_001143679.1 | 80.1% | 80.1% | 384_551del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 744
- ORF length:
- 678
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gcccctgccg cgcaccgtgg agctcttcta tgacgtgctg tccccctact 121 cctggctggg cttcgagatc ctgtgccggt atcagaatat ctggaacatc aacctgcagt 181 tgcggcccag cctcataaca gggatcatga aagacagtgg aaacaagcct ccaggtctgc 241 ttccccgcaa aggactatac atggcaaatg acttaaagct cctgagacac catctccaga 301 ttcccatcca cttccccaag gatttcttgt ctgtgatgct tgaaaaagga agtttgtctg 361 ccatgcgttt cctcaccgcc gtgaacttgg agcatccaga gatgctggag aaagcgtccc 421 gggagctgtg gatgcgcgtc tggtcaagga atgaagacat caccgagccg cagagcatCC 481 TGGCGGCTGC AGAGAAGGCT GGTATGTCTG CAGAACAAGC CCAGGGACTT CTGGAAAAGA 541 TCGCAACGCC AAAGGTGAAG AACCAGCTCA AGGAGACCAC TGAGGCAGCC TGCAGATACG 601 GAGCCTTTGG GCTGCCCATC ACCGTGGCCC ATGTGGATGG CCAAACCCAC ATGTTATTTG 661 GCTCTGACCG GATGGAGCTG CTGGCGCACC TGCTGGGAGA GAAGTGGATG GGCCCTATAC 721 CTCCAGCCGT GAATGCCAGA CTTTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 781 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 841 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC CAGAACTCAC 901 ATCATCCAGC ACCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 961 att