Construct: ORF TRCN0000467216
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005015.1_s317c1
- Derived from:
- ccsbBroadEn_05880
- DNA Barcode:
- TAGCCGTCAGTGGGACTTTTCTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCND1 (595)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467216
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 595 | CCND1 | cyclin D1 | NM_053056.3 | 99.8% | 100% | 723G>A |
| 2 | mouse | 12443 | Ccnd1 | cyclin D1 | NM_007631.2 | 90% | 93.8% | (many diffs) |
| 3 | mouse | 12443 | Ccnd1 | cyclin D1 | XM_011241977.1 | 83.8% | 87.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 951
- ORF length:
- 885
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga acaccagctc ctgtgctgcg aagtggaaac catccgccgc gcgtaccccg 121 atgccaacct cctcaacgac cgggtgctgc gggccatgct gaaggcggag gagacctgcg 181 cgccctcggt gtcctacttc aaatgtgtgc agaaggaggt cctgccgtcc atgcggaaga 241 tcgtcgccac ctggatgctg gaggtctgcg aggaacagaa gtgcgaggag gaggtcttcc 301 cgctggccat gaactacctg gaccgcttcc tgtcgctgga gcccgtgaaa aagagccgcc 361 tgcagctgct gggggccact tgcatgttcg tggcctctaa gatgaaggag accatccccc 421 tgacggccga gaagctgtgc atctacaccg acaactccat ccggcccgag gagctgctgc 481 aaatggagct gctcctggtg aacaagctca agtggaacct ggccgcaatg accccgcacg 541 atttcattga acacttcctc tccaaaatgc cagaggcgga ggagaacaaa cagatcatcc 601 gcaaacacgc gcagaccttc gttgcccTCT GTGCCACAGA TGTGAAGTTC ATTTCCAATC 661 CGCCCTCCAT GGTGGCAGCG GGGAGCGTGG TGGCCGCAGT GCAAGGCCTG AACCTGAGGA 721 GCCCCAACAA CTTCCTGTCC TACTACCGCC TCACACGCTT CCTCTCCAGA GTGATCAAGT 781 GTGACCCAGA CTGCCTCCGG GCCTGCCAGG AGCAGATCGA AGCCCTGCTG GAGTCAAGCC 841 TGCGCCAGGC CCAGCAGAAC ATGGACCCCA AGGCCGCCGA GGAGGAGGAA GAGGAGGAGG 901 AGGAGGTGGA CCTGGCTTGC ACACCCACCG ACGTGCGGGA CGTGGACATC TGCCCAACTT 961 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1021 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1081 CTTGTGGAAA GGACGATAGC CGTCAGTGGG ACTTTTCTTA ACGCGTTAAG TCgacaatca 1141 acctctggat tacaaaattt gtgaaagatt