Construct: ORF TRCN0000467234
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002614.1_s317c1
- Derived from:
- ccsbBroadEn_03271
- DNA Barcode:
- GTACAGAATACCCGCTGTAAGCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ECSIT (51295)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467234
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51295 | ECSIT | ECSIT signaling integrator | NM_001142464.3 | 100% | 100% | |
2 | human | 51295 | ECSIT | ECSIT signaling integrator | NM_001243204.1 | 93.8% | 87% | 796_823del;888_889ins28 |
3 | human | 51295 | ECSIT | ECSIT signaling integrator | NM_016581.5 | 68.6% | 63.1% | 796_944del;1038_1293del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 954
- ORF length:
- 888
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ctgggtccag gccaccctac tggcccgagg cctctgtagg gcctggggag 121 gcacctgcgg ggccgccctc acaggaacct ccatctctca ggtccctcgc cggctccctc 181 ggggcctcca ctgcagcgca gctgcccata gctctgaaca gtccctggtt cccagcccac 241 cggaaccccg gcagaggccc accaaggctc tggtgccctt tgaggacctg tttgggcagg 301 cgcctggtgg ggaacgggac aaggcgagct tcctgcagac ggtgcagaaa tttgcggagc 361 acagcgtgcg taagcggggc cacattgact tcatctacct ggccctgcgc aagatgcggg 421 agtatggtgt cgagcgggac ctggctgtgt acaaccagct gctcaacatc ttccccaagg 481 aggtcttccg gcctcgcaac atcatccagc gcatcttcgt ccactaccct cggcagcagg 541 agtgtgggat tgctgtcctg gagcagatgg agaaccacgg tgtgatgccc aacaaggaga 601 cggagttccT GCTGATTCAG ATCTTTGGAC GCAAAAGCTA CCCCATGCTC AAGTTGGTGC 661 GCCTGAAGCT GTGGTTCCCT CGATTCATGA ACGTCAACCC CTTCCCAGTG CCCCGGGACC 721 TGCCCCAGGA CCCTGTGGAG CTGGCCATGT TTGGCCTGCG GCACATGGAG CCTGACCTTA 781 GTGCCAGGGT CACCATCTAC CAGGTTCCTT TGCCCAAAGA CTCAACAGGT GCAGCAGATC 841 CCCCCCAGCC CCACATCGTA GGAAGTGGAA GAGACGCCGG AGGAGTGGAA CCTCTACTAC 901 CCGATGCAGC TGGACCTGGA GTATGTGAGG AGTGGCTGGG ACAACTACGA GTTTGCCCAA 961 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1021 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1081 TATCTTGTGG AAAGGACGAG TACAGAATAC CCGCTGTAAG CCTACGCGTT AAGTCgacaa 1141 tcaacctctg gattacaaaa tttgtgaaag att