Construct: ORF TRCN0000467399
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003659.1_s317c1
- Derived from:
- ccsbBroadEn_08452
- DNA Barcode:
- TCTATCTCCGTCTGTAGATCTGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIH1D1 (55011)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467399
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55011 | PIH1D1 | PIH1 domain containing 1 | NM_017916.3 | 99.4% | 98.6% | (many diffs) |
2 | human | 55011 | PIH1D1 | PIH1 domain containing 1 | XM_024451568.1 | 69.3% | 68.9% | (many diffs) |
3 | human | 55011 | PIH1D1 | PIH1 domain containing 1 | XR_430202.4 | 67% | (many diffs) | |
4 | human | 55011 | PIH1D1 | PIH1 domain containing 1 | XM_024451569.1 | 55.8% | 54.1% | (many diffs) |
5 | human | 55011 | PIH1D1 | PIH1 domain containing 1 | XM_024451570.1 | 55.8% | 54.1% | (many diffs) |
6 | human | 55011 | PIH1D1 | PIH1 domain containing 1 | XR_430203.3 | 53.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 936
- ORF length:
- 870
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gaacccgaag ctgctgggac tggagctaag cgaggcggag gcgatcggtg 121 ctgattcggc gcgatttgag gagctgctgc tgcaggcctc gaaggagctc cagcaagccc 181 agacaaccag accagaatcg acacaaatcc agcctcagcc tggtttctgc ataaagacca 241 actcctcgga agggaaggtt ttcatcaaca tctgccactc cccctctatc cctcctcccg 301 ccgacgtgac cgaggaggag ctgcttcaga tgctagagga ggaccaagct gggtttcgca 361 tccccatgag tctgggagag cctcatgcag aactggatgc aaaaggccag ggatgtaccg 421 cctacgacgt agctgtcaac agcgacttct accggaggat gcagaacagc gatttcttgc 481 gggagctcgt gatcaccatc gccagggagg gccttgagga caaatacaac ttgcagctga 541 atccggaatg gcgcatgatg aagaaccggC CATTCATGGG CTCCATCTCG CAGCAGAACA 601 TCCGCTCGGA GCAGCGTCCT CGGATCCAGG AGCTGGGGGA CCTGTACACG CCCGCCCCCG 661 GGAGAGCTGA GTCAGGCCCT GAAAAGCCTC ACCTGAACCT GTGGCTGGAA GCCCCCGACC 721 TCCTCTTGGC CGAAATTGAC CTCCCCAAAC TGGATGGAGC CCTGGGGCTG TCGCTGGAGA 781 TCGGGGAGAA CCGCCTGGTG ATGGGGGGCC CCCAGCAGCT GTATCATCTA GACGCTTATA 841 TCCCGCTGCA GATCAACTCT CATGAGAGCA AGGCAGCCTT CCACCGGAAG AGAAAGCAAT 901 TAATGGTGGC CATGCCGCTT CTGCTGGTGC CTTCTTGCCC AACTTTCTTG TACAAAGTGG 961 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1021 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1081 ATCTATCTCC GTCTGTAGAT CTGTCACGCG TTAAGTCgac aatcaacctc tggattacaa 1141 aatttgtgaa agatt