Construct: ORF TRCN0000467579
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015740.1_s317c1
- Derived from:
- ccsbBroadEn_10917
- DNA Barcode:
- GTTCTTCATCGATCGCATCCCCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IGLC1 (3537)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467579
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 100423062 | IGLL5 | immunoglobulin lambda like ... | NM_001178126.2 | 62.4% | 53.7% | (many diffs) |
| 2 | human | 100423062 | IGLL5 | immunoglobulin lambda like ... | NM_001256296.2 | 55.7% | 44.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 765
- ORF length:
- 699
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctggaccgtt ctcctcctcg gcctcctctc tcactgcaca ggttcaggga 121 cctcctatgt gttgactcag ccagcctcgg tgtcagtggc cccaggacag acggccagga 181 ttacctgtgg gggaagcaac cttggaagca aaagtgttaa ctggtatcaa ctgaggccag 241 gccaggcccc tattctggtc gtctatgaaa ataaagagcg gcccgcaggg atccctgagc 301 gactctccgc cctcacttct gaggaaacgg ccaccctcac catcagcagc gtcgtcgccg 361 gggatgaggc cgactatttc TGTCAGGTGT GGGACACTAC TAGTCAACAA TATGTCTTCG 421 GAACTGGGAC CCAGGTCACC GTCCTAGGTC AGCCCAAGGC CAACCCCACT GTCACTCTGT 481 TCCCGCCCTC CTCTGAGGAG CTCCAAGCCA ATAAGGCCAC ACTAGTGTGT CTGATCAGTG 541 ACTTCTACCC GGGAGCTGTG ACAGTGGCCT GGAAGGCAGA TGGCAGCCCC GTCAAGGCGG 601 GAGTGGAGAC CACCAAACCC TCCAAACAGA GCAACAACAA GTACGCGGCC AGCAGCTACC 661 TGAGCCTGAC GCCCGAGCAG TGGAAGTCCC ACAGAAGCTA CAGCTGCCAG GTCACGCATG 721 AAGGGAGCAC CGTGGAGAAG ACAGTGGCCC CTACAGAATG TTCATACCCA ACTTTCTTGT 781 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 841 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 901 GAAAGGACGA GTTCTTCATC GATCGCATCC CCTCACGCGT TAAGTCgaca atcaacctct 961 ggattacaaa atttgtgaaa gatt