Construct: ORF TRCN0000467961
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006330.1_s317c1
- Derived from:
- ccsbBroadEn_02113
- DNA Barcode:
- TAGCTGTAGGACACGTCGAGGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRAT (9227)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467961
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9227 | LRAT | lecithin retinol acyltransf... | NM_001301645.1 | 100% | 100% | |
| 2 | human | 9227 | LRAT | lecithin retinol acyltransf... | NM_004744.5 | 100% | 100% | |
| 3 | human | 9227 | LRAT | lecithin retinol acyltransf... | XR_938793.2 | 54.3% | 1_332del;872_1071del;1223_1269del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 756
- ORF length:
- 690
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gaaccccatg ctggaggtgg tgtctttact actggagaag ctgctcctca 121 tctccaactt cacgctcttt agttcgggcg ccgcgggcga agacaaaggg aggaacagtt 181 tttatgaaac cagctctttc caccgaggcg acgtgctgga ggtgccccgg acccacctga 241 cccactatgg catctaccta ggagacaacc gtgttgccca catgatgccc gacatcctgt 301 tggccctgac agacgacatg gggcgcacgc agaaggtggt ctccaacaag cgtctcatcc 361 tgggcgttat tgtcaaagtg gccagcatcc gcgtggacac agtggaggac ttcgccTACG 421 GAGCTAACAT CCTGGTCAAT CACCTGGACG AGTCCCTCCA GAAAAAGGCA CTGCTCAACG 481 AGGAGGTGGC GCGGAGGGCT GAAAAGCTGC TGGGCTTTAC CCCCTACAGC CTGCTGTGGA 541 ACAACTGCGA GCACTTCGTG ACCTACTGCA GATATGGCAC CCCGATCAGT CCCCAGTCCG 601 ACAAGTTTTG TGAGACTGTG AAGATAATTA TTCGTGATCA GAGAAGTGTT CTTGCTTCAG 661 CAGTCTTGGG ATTGGCGTCT ATAGTCTGTA CGGGCTTGGT ATCATACACT ACCCTTCCTG 721 CAATTTTTAT TCCATTCTTC CTATGGATGG CTGGCTACCC AACTTTCTTG TACAAAGTGG 781 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 841 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 901 ATAGCTGTAG GACACGTCGA GGTCAACGCG TTAAGTCgac aatcaacctc tggattacaa 961 aatttgtgaa agatt