Construct: ORF TRCN0000468086
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014727.1_s317c1
- Derived from:
- ccsbBroadEn_02497
- DNA Barcode:
- CGCTCACTGGTGGACACGGGAACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- YKT6 (10652)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468086
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10652 | YKT6 | YKT6 v-SNARE homolog | NM_006555.4 | 100% | 100% | |
| 2 | human | 10652 | YKT6 | YKT6 v-SNARE homolog | XM_005249582.4 | 95.6% | 94.4% | (many diffs) |
| 3 | human | 10652 | YKT6 | YKT6 v-SNARE homolog | NM_001363678.2 | 82.8% | 82.8% | 459_460ins102 |
| 4 | mouse | 56418 | Ykt6 | YKT6 v-SNARE homolog (S. ce... | NM_019661.4 | 89% | 92.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 660
- ORF length:
- 594
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gctgtacagc ctcagcgtcc tctacaaagg cgaggccaag gtggtgctgc 121 tcaaagccgc atacgatgtg tcttccttca gctttttcca gagatccagc gttcaggaat 181 tcatgacctt cacgagtcaa ctgattgtgg agcgctcatc gaaaggcact agagcttctg 241 tcaaagaaca agactatctg tgccacgtct acgtccggaa tgatagtctt gcaggtgtgg 301 tcattgctga caatgaatac ccatcccggg tggcctttac cttgctggag aaggTACTAG 361 ATGAATTCTC CAAGCAAGTC GACAGGATAG ACTGGCCAGT AGGATCCCCT GCTACAATCC 421 ATTACCCAGC CCTGGATGGT CACCTCAGTA GATACCAGAA CCCACGAGAA GCTGATCCCA 481 TGACTAAAGT GCAGGCCGAA CTAGATGAGA CCAAAATCAT TCTGCACAAC ACCATGGAGT 541 CTCTGTTAGA GCGAGGTGAG AAGCTAGATG ACTTGGTGTC CAAATCCGAG GTGCTGGGAA 601 CACAGTCTAA AGCCTTCTAT AAAACTGCCC GGAAACAAAA CTCATGCTGT GCCATCATGT 661 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 721 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 781 TTTATATATC TTGTGGAAAG GACGACGCTC ACTGGTGGAC ACGGGAACGA CGCGTTAAGT 841 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt