Construct: ORF TRCN0000468329
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000951.1_s317c1
- Derived from:
- ccsbBroadEn_10825
- DNA Barcode:
- GCTTCTCTAGTGAAAGTAATTTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FMR1 (2332)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468329
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2332 | FMR1 | FMRP translational regulator 1 | NM_001185081.2 | 57.4% | 57.1% | (many diffs) |
| 2 | human | 2332 | FMR1 | FMRP translational regulator 1 | NM_001185075.1 | 55.1% | 54.9% | (many diffs) |
| 3 | human | 2332 | FMR1 | FMRP translational regulator 1 | NM_001185082.2 | 50.5% | 50.3% | (many diffs) |
| 4 | human | 2332 | FMR1 | FMRP translational regulator 1 | NM_001185076.1 | 48.4% | 48.2% | (many diffs) |
| 5 | human | 2332 | FMR1 | FMRP translational regulator 1 | NM_002024.5 | 46.8% | 46.6% | (many diffs) |
| 6 | human | 2332 | FMR1 | FMRP translational regulator 1 | NR_033700.2 | 21.2% | (many diffs) | |
| 7 | human | 2332 | FMR1 | FMRP translational regulator 1 | NR_033699.2 | 20.9% | (many diffs) | |
| 8 | mouse | 14265 | Fmr1 | fragile X mental retardatio... | XM_006527814.1 | 49.1% | 51.2% | (many diffs) |
| 9 | mouse | 14265 | Fmr1 | fragile X mental retardatio... | XM_006527813.1 | 48% | 50% | (many diffs) |
| 10 | mouse | 14265 | Fmr1 | fragile X mental retardatio... | NM_001290424.1 | 47.4% | 49.4% | (many diffs) |
| 11 | mouse | 14265 | Fmr1 | fragile X mental retardatio... | XM_006527811.1 | 47.1% | 49% | (many diffs) |
| 12 | mouse | 14265 | Fmr1 | fragile X mental retardatio... | XM_006527810.1 | 46.4% | 48.3% | (many diffs) |
| 13 | mouse | 14265 | Fmr1 | fragile X mental retardatio... | NM_008031.3 | 45.4% | 47.3% | (many diffs) |
| 14 | mouse | 14265 | Fmr1 | fragile X mental retardatio... | XR_001782738.1 | 16.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 957
- ORF length:
- 891
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggagctggtg gtggaagtgc ggggctccaa tggcgctttc tacaaggcat 121 ttgtaaagga tgttcatgaa gattcaataa cagttgcatt tgaaaacaac tggcagcctg 181 ataggcagat tccatttcat gatgtcagat tcccacctcc tgtaggttat aataaagata 241 taaatgaaag tgatgaagtt gaggtgtatt ccagagcaaa tgaaaaagag ccttgctgtt 301 ggtggttagc taaagtgagg atgataaagg gtgagtttta tgtgatagaa tatgcagcat 361 gtgatgcaac ttacaatgaa attgtcacaa ttgaacgtct aagatctgtt aatcccaaca 421 aacctgccac aaaagatact ttccataaga tcaagctgga tgtgccagaa gacttacggc 481 aaatgtgtgc caaagaggcg gcacataagg attttaaaaa ggcagttggt gcctttTCTG 541 TAACTTATGA TCCAGAAAAT TATCAGCTTG TCATTTTGTC CATCAATGAA GTCACCTCAA 601 AGCGAGCACA TATGCTGATT GACATGCACT TTCGGAGTCT GCGCACTAAG TTGTCTCTGA 661 TAATGAGAAA TGAAGAAGCT AGTAAGCAGC TGGAGAGTTC AAGGCAGCTT GCCTCGAGAT 721 TTCATGAACA GTTTATCGTA AGAGAAGATC TGATGGGTCT AGCTATTGGT ACTCATGGTG 781 CTAATATTCA GCAAGCTAGA AAAGTACCTG GGGTCACTGC TATTGATCTA GATGAAGATA 841 CCTGCACATT TCATATTTAT GGAGAGGATC AGGATGCAGT GAAAAAAGCT AGAAGCTTTC 901 TCGAATTTGC TGAAGATGTA ATACAAGTTC CAAGGAACTT AGTAGGGTTG AAGATCTGCC 961 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1021 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1081 ATATATCTTG TGGAAAGGAC GAGCTTCTCT AGTGAAAGTA ATTTTGACGC GTTAAGTCga 1141 caatcaacct ctggattaca aaatttgtga aagatt