Construct: ORF TRCN0000468361
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011693.1_s317c1
- Derived from:
- ccsbBroadEn_12807
- DNA Barcode:
- ATCTGACGCGAACGTGTTGTTGAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MON1A (84315)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468361
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84315 | MON1A | MON1 homolog A, secretory t... | NM_001142501.1 | 73% | 73% | 1_396del |
2 | human | 84315 | MON1A | MON1 homolog A, secretory t... | XM_006713345.4 | 63.9% | 63.2% | (many diffs) |
3 | human | 84315 | MON1A | MON1 homolog A, secretory t... | XM_011534160.1 | 63.9% | 63.2% | (many diffs) |
4 | human | 84315 | MON1A | MON1 homolog A, secretory t... | NM_032355.3 | 54.4% | 53.8% | (many diffs) |
5 | mouse | 72825 | Mon1a | MON1 homolog A, secretory t... | XM_017313611.1 | 84.3% | 86.5% | (many diffs) |
6 | mouse | 72825 | Mon1a | MON1 homolog A, secretory t... | NM_028369.3 | 58.5% | 62.2% | (many diffs) |
7 | mouse | 72825 | Mon1a | MON1 homolog A, secretory t... | XM_017313610.1 | 58.5% | 62.2% | (many diffs) |
8 | mouse | 72825 | Mon1a | MON1 homolog A, secretory t... | XR_001779021.1 | 35.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1140
- ORF length:
- 1074
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ccagggaatg gagccagatg gctacaaggt agtattcgtg cgccggagcc 121 cgctggtgct agtggcggtg gctcgtacgc ggcagtcggc acaagagctg gcgcaggagc 181 tgctctacat ctactaccag atcctaagcc ttcttaccgg tgcgcagctg agccacatct 241 tccagcagaa gcagaactat gatttgcggc gcctactctc gggctcagag cgcatcaccg 301 acaacctgct gcagctcatg gcacgagacc ccagcttcct gatgggggcg gcacggtgcc 361 tgcccctggc ggcggccgtg cgcgacactg tgagcgccag cctgcagcag gcgcgtgcgc 421 gcagcctggt cttctccatc ctgctggccc gcaaccagct cgtggcactc gtgcgccgaa 481 aggaccaatt tctgcacccc atcgacctgc acctgctctt caacctcatt agttcctcct 541 cgtcctttcg cgagggcgag gcctggacgc ccgtgtgcct gcccaaattc aacgcagccg 601 gcttcttcca cgcacacatc tcttacctag agcctgacac tgacctctgc ctgctgcttg 661 tctccactga ccgtgaggac ttctttgcag tctctgactg ccgccgccgc ttccaggagc 721 gccttcgcaa gcgcggagcc cacctggccc tgcgagaggc actgcgcaca ccctacTACA 781 GCGTTGCCCA AGTGGGCATC CCTGACCTGC GTCACTTCCT CTATAAGTCA AAGAGCTCGG 841 GACTCTTCAC CAGCCCTGAG ATTGAGGCCC CATACACCAG TGAAGAGGAG CAGGAGCGGC 901 TGCTGGGCCT CTACCAGTAC TTGCACAGTC GTGCCCACAA TGCCTCTCGC CCACTCAAGA 961 CCATTTACTA CACGGGCCCC AACGAGAACC TCCTGGCCTG GGTGACAGGC GCCTTTGAGC 1021 TCTACATGTG TTACAGCCCC CTGGGGACCA AGGCGTCAGC CGTCAGTGCC ATCCATAAGC 1081 TGATGCGCTG GATCCGCAAA GAGGAAGACC GCCTCTTCAT TCTCACGCCC CTCACCTATT 1141 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1201 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1261 TTTATATATC TTGTGGAAAG GACGAATCTG ACGCGAACGT GTTGTTGAGA CGCGTTAAGT 1321 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt