Construct: ORF TRCN0000468674
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012050.1_s317c1
- Derived from:
- ccsbBroadEn_11270
- DNA Barcode:
- TAGTGCATGCTGACGATATCGAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIP4K2B (8396)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468674
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8396 | PIP4K2B | phosphatidylinositol-5-phos... | NM_003559.4 | 66.3% | 64.5% | (many diffs) |
| 2 | human | 8396 | PIP4K2B | phosphatidylinositol-5-phos... | XM_011525326.3 | 62.3% | 60.6% | (many diffs) |
| 3 | human | 8396 | PIP4K2B | phosphatidylinositol-5-phos... | XM_011525327.2 | 47.9% | 46.3% | (many diffs) |
| 4 | human | 8396 | PIP4K2B | phosphatidylinositol-5-phos... | XM_017025197.1 | 30.7% | 25.2% | (many diffs) |
| 5 | human | 8396 | PIP4K2B | phosphatidylinositol-5-phos... | XM_011525330.2 | 26.5% | 25% | (many diffs) |
| 6 | human | 8396 | PIP4K2B | phosphatidylinositol-5-phos... | XM_017025199.1 | 26.1% | 24.2% | (many diffs) |
| 7 | mouse | 108083 | Pip4k2b | phosphatidylinositol-5-phos... | NM_054051.1 | 60.7% | 64.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 909
- ORF length:
- 843
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc gtccaactgc accagcacca cggcggtggc ggtggcgccg ctcagcgcca 121 gcaagaccaa gaccaagaag aagcatttcg tgtgccagaa agtgaagcta ttccgggcca 181 gcgagccgat cctcagcgtc ctgatgtggg gggtgaacca cacgatcaat gagctgagca 241 atgttcctgt tcctgtcatg ctaatgccag atgacttcaa agcctacagc aagatcaagg 301 tggacaatca tctcttcaat aaggagaacc tgcccagccg ctttaagttt aaggagtatt 361 gccccatggt gttccgaaac cttcgggaga ggtttggaat tgatgatcag gattaccaga 421 attcagtgac gcgcagcgcc cccatcaaca gtgacagcca gggtcggtgt ggcacgcgtt 481 tcctcaccac cTACGACCGG CGCTTTGTCA TCAAGACTGT GTCCAGCGAG GACGTGGCGG 541 AGATGCACAA CATCTTAAAG AAATACCACC AGTTTATAGT GGAGTGTCAT GGCAACACGC 601 TTTTGCCACA GTTCCTGGGC ATGTACCGCC TGACCGTGGA TGGTGTGGAA ACCTACATGG 661 TGGTTACCAG GAACGTGTTC AGCCATCGGC TCACTGTGCA TCGCAAGTAT GACCTCAAGG 721 GTTCTACGGT TGCCAGAGAA GCGAGCGACA AGGAGAAGGC CAAGGACTTG CCAACATTCA 781 AAGACAATGA CTTCCTCAAT GAAGGGCAGA AGCTGCATGT GGGAGAGGAG AGTAAAAAGA 841 ACTTCCTGGA GAAACTGAAG CGGGACGTTG AGGAGATTCT CGTTCTGTCC CCAGGCAGGA 901 GAATCGCTTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 961 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1021 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATAGTGC ATGCTGACGA TATCGAACAC 1081 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt