Construct: ORF TRCN0000470222
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010452.1_s317c1
- Derived from:
- ccsbBroadEn_07664
- DNA Barcode:
- GAGACATGGCCCCCTATTAAGAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPINT2 (10653)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470222
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10653 | SPINT2 | serine peptidase inhibitor,... | NM_021102.4 | 99.8% | 99.6% | 598G>C |
| 2 | human | 10653 | SPINT2 | serine peptidase inhibitor,... | NM_001166103.2 | 77.2% | 76.9% | 105_106ins171;427G>C |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 822
- ORF length:
- 756
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gcagctgtgc gggctgaggc ggagccgggc gtttctcgcc ctgctgggat 121 cgctgctcct ctctggggtc ctggcggccg accgagaacg cagcatccac gacttctgcc 181 tggtgtcgaa ggtggtgggc agatgccggg cctccatgcc taggtggtgg tacaatgtca 241 ctgacggatc ctgccagctg tttgtgtatg ggggctgtga cggaaacagc aataattacc 301 tgaccaagga ggagtgcctc aagaaatgtg ccactgtcac agagaatgcc acgggtgacc 361 tggccaccag caggaatgca gcggattcct ctgtcccaag tgctcccaga aggcaggatt 421 ctgaagacca ctccagcgat atgttcaact atgaagaata ctgcaccgcc aacgcagtca 481 ctgGGCCTTG CCGTGCATCC TTCCCACGCT GGTACTTTGA CGTGGAGAGG AACTCCTGCA 541 ATAACTTCAT CTATGGAGGC TGCCGGGGCA ATAAGAACAG CTACCGCTCT GAGGAGGCCT 601 GCATGCTCCG CTGCTTCCGC CAGCAGGAGA ATCCTCCCCT GCCCCTTGGC TCAAAGGTGG 661 TGCTTCTGGC GGGGCTGTTC GTGATGGTGT TGATCCTCTT CCTGGGAGCC TCCATGGTCT 721 ACCTGATCCG GGTGGCACGG AGGAACCAGG AGCGTGCCCT GCGCACCGTC TGGAGCTCCG 781 GAGATGACAA GGAGCAGCTG GTGAAGAACA CATATGTCCT GTGCCCAACT TTCTTGTACA 841 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 901 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 961 AGGACGAGAG ACATGGCCCC CTATTAAGAG AACGCGTTAA GTCgacaatc aacctctgga 1021 ttacaaaatt tgtgaaagat t