Construct: ORF TRCN0000470921
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016537.1_s317c1
- Derived from:
- ccsbBroadEn_13550
- DNA Barcode:
- GAGTTAGAATATGATCAACCGTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPUSD3 (285367)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470921
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 285367 | RPUSD3 | RNA pseudouridine synthase D3 | NM_173659.4 | 97.6% | 97.4% | 1_24del;100G>C |
| 2 | human | 285367 | RPUSD3 | RNA pseudouridine synthase D3 | NM_001142547.2 | 93.3% | 93.1% | 1_24del;100G>C;260_261ins45 |
| 3 | human | 285367 | RPUSD3 | RNA pseudouridine synthase D3 | XM_024453471.1 | 79.3% | 79.8% | (many diffs) |
| 4 | human | 285367 | RPUSD3 | RNA pseudouridine synthase D3 | NM_001351738.1 | 75.3% | 56.4% | (many diffs) |
| 5 | human | 285367 | RPUSD3 | RNA pseudouridine synthase D3 | XM_024453472.1 | 69% | 66.9% | (many diffs) |
| 6 | human | 285367 | RPUSD3 | RNA pseudouridine synthase D3 | NM_001351737.1 | 66.8% | 66% | (many diffs) |
| 7 | human | 285367 | RPUSD3 | RNA pseudouridine synthase D3 | NM_001351736.2 | 60.4% | 59.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1095
- ORF length:
- 1029
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cggccgccgt gttttgggcc ggttctggag tggctggcgg cggggcctgg 121 gtgtccgccc agtgcccgag cacgcaggct ttggcaccga agcccggcat cagaggcaac 181 cccgcggctc ctgccaacgg tcggggcccc tcggggacca gcccttcgcg gggctgctgc 241 caaaaaacct cagtcgggag gagctggttg atgcgctgcg ggcagccgtg gtggaccgga 301 aaggacctct agtgacgttg aacaagccac agggtctacc agtgacagga aaaccaggag 361 agctgacgtt gttctcagtg ctgccagagc tgagccagtc cctagggctc agggagcagg 421 agcttcaggt tgtccgagca tctgggaaag aaagctctgg gcttgtactc ctctccagct 481 gtccccagac agctagtcgc ctccagaagt acttcaccca tgcacggaga gcccaaaggc 541 ccacagccac ctactgtgct gtcactgatg ggatcccagc tgcttctgag gggaagatcc 601 aggctgccct gaaactggaa cacattgatg gggtcaatct cacagttcca gtgaaggccc 661 catcccgaaa ggacatcctg gaaggtgtca agaagactct cagtcacttt cgtgtggtag 721 ccacaggctc tggctgtgcc ctggtccagc tgcagccact gacagtgttc tccagtcaac 781 tacaggtgca catggtacta cagctctgcc ctgtgcttgg ggaccacatg tactctgccc 841 gtgtgggcac tgtcctgggc cagcgatttc tgctgccagc TGAGAACAAC AAGCCCCAAA 901 GACAGGTCCT GGATGAAGCC CTCCTCAGAC GCCTCCACCT GACCCCCTCC CAGGCTGCCC 961 AGCTGCCCTT GCACCTCCAC CTACATCGGC TCCTTCTCCC AGGCACCAGG GCCAGGGACA 1021 CCCCTGTTGA GCTCCTGGCA CCACTGCCCC CTTATTTCTC CAGGACCCTA CAGTGCCTGG 1081 GGCTCCGCTT ACAATACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1141 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1201 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GAGTTAGAAT ATGATCAACC 1261 GTGTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt