Construct: ORF TRCN0000471214
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007718.1_s317c1
- Derived from:
- ccsbBroadEn_06319
- DNA Barcode:
- AAATTCGTCAAGGTCTGCCCTCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR35 (2859)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471214
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2859 | GPR35 | G protein-coupled receptor 35 | NM_005301.3 | 99.8% | 99.6% | 880A>C |
2 | human | 2859 | GPR35 | G protein-coupled receptor 35 | NM_001195381.2 | 90.7% | 90.5% | 1_93del;973A>C |
3 | human | 2859 | GPR35 | G protein-coupled receptor 35 | NM_001195382.2 | 90.7% | 90.5% | 1_93del;973A>C |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 996
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaatggcacc tacaacacct gtggctccag cgacctcacc tggcccccag 121 cgatcaagct gggcttctac gcctacttgg gcgtcctgct ggtgctaggc ctgctgctca 181 acagcctggc gctctgggtg ttctgctgcc gcatgcagca gtggacggag acccgcatct 241 acatgaccaa cctggcggtg gccgacctct gcctgctgtg caccttgccc ttcgtgctgc 301 actccctgcg agacacctca gacacgccgc tgtgccagct ctcccagggc atctacctga 361 ccaacaggta catgagcatc agcctggtca cggccatcgc cgtggaccgc tatgtggccg 421 tgcggcaccc gctgcgtgcc cgcgggctgc ggtcccccag gcaggctgcg gccgtgtgcg 481 cggtcctctg ggtgctggtc atcggctccc tggtggctcg ctggctcctg gggattcagg 541 agggcggctt ctgcttcagg agcacccggc acaatttcaa ctccatGGCG TTCCCGCTGC 601 TGGGATTCTA CCTGCCCCTG GCCGTGGTGG TCTTCTGCTC CCTGAAGGTG GTGACTGCCC 661 TGGCCCAGAG GCCACCCACC GACGTGGGGC AGGCAGAGGC CACCCGCAAG GCTGCCCGCA 721 TGGTCTGGGC CAACCTCCTG GTGTTCGTGG TCTGCTTCCT GCCCCTGCAC GTGGGGCTGA 781 CAGTGCGCCT CGCAGTGGGC TGGAACGCCT GTGCCCTCCT GGAGACGATC CGTCGCGCCC 841 TGTACATAAC CAGCAAGCTC TCAGATGCCA ACTGCTGCCT GGACGCCATC TGCTACTACT 901 ACATGGCCAA GGAGTTCCAG GAGGCGTCTG CACTGGCCGT GGCTCCCCGT GCTAAGGCCC 961 ACAAAAGCCA GGACTCTCTG TGCGTGACCC TCGCCTTGCC AACTTTCTTG TACAAAGTGG 1021 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1081 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1141 AAAATTCGTC AAGGTCTGCC CTCGCACGCG TTAAGTCgac aatcaacctc tggattacaa 1201 aatttgtgaa agatt