Construct: ORF TRCN0000471875
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010271.1_s317c1
- Derived from:
- ccsbBroadEn_07256
- DNA Barcode:
- CCGCCCGACGACAGACGTACGTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- COPS3 (8533)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471875
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | NM_003653.4 | 99.9% | 100% | 573C>T |
| 2 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | NM_001199125.1 | 95.1% | 95.2% | 0_1ins60;513C>T |
| 3 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | XM_005256837.4 | 95.1% | 95.2% | 0_1ins60;513C>T |
| 4 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | NM_001316355.1 | 86.2% | 86.2% | 573C>T;759_760ins174 |
| 5 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | NM_001316356.1 | 84% | 84.1% | 0_1ins201;372C>T |
| 6 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | NM_001316357.1 | 75% | 72.4% | 0_1ins265;33_34ins50;258C>T |
| 7 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | NM_001316358.1 | 75% | 72.4% | 0_1ins265;33_34ins50;258C>T |
| 8 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | XM_017025246.1 | 75% | 72.4% | 0_1ins265;33_34ins50;258C>T |
| 9 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | NM_001316354.1 | 69.1% | 69.2% | 0_1ins390;183C>T |
| 10 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | XM_005256840.3 | 69.1% | 69.2% | 0_1ins390;183C>T |
| 11 | human | 8533 | COPS3 | COP9 signalosome subunit 3 | XM_005256842.4 | 69.1% | 69.2% | 0_1ins390;183C>T |
| 12 | mouse | 26572 | Cops3 | COP9 signalosome subunit 3 | NM_011991.1 | 91.8% | 99.5% | (many diffs) |
| 13 | mouse | 26572 | Cops3 | COP9 signalosome subunit 3 | XM_006533383.3 | 62.8% | 68.7% | (many diffs) |
| 14 | mouse | 26572 | Cops3 | COP9 signalosome subunit 3 | XR_001780008.1 | 24.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1335
- ORF length:
- 1269
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtctgccctg gagcagttcg tgaacagtgt ccgacagctc tcagctcaag 121 ggcaaatgac acagctttgt gaactgatca acaagagtgg ggaactcctt gcgaagaact 181 tatcccatct ggacactgtg ctcggggctc tggatgtaca agaacactcc ttgggcgtcc 241 ttgctgtttt gtttgtgaag ttttctatgc ccagtgttcc tgacttcgaa acgctattct 301 cacaggttca gctcttcatc agcacttgta atggggagca cattcgatat gcaacagaca 361 cttttgctgg gctttgccat cagctaacaa atgcacttgt ggaaagaaaa cagcccctgc 421 gaggaattgg catccttaag caagccatag acaagatgca gatgaataca aaccagctga 481 cctcaataca tgctgatctc tgccagcttt gtttgctagc aaaatgcttt aagcctgccc 541 ttccatatct tgacgtggat atgatggata tctgtaaaga gaatggagcc tatgatgcaa 601 aacacttttt atgttactat tattatggag ggatgattta tactgggctg aagaactttg 661 aaagagctct ctacttttat gaacaggcta taactactcc tgccatggcg gtcagtcata 721 tcatgttgga atcatataaa aagtatattt tagtgtcttt gatattactt ggcaaagtac 781 aacagctacc aaaatataca tctcaaattg tgggtagatt cattaagcct cttagcaatg 841 cataccacga gttagcacaa gtgtattcaa ccaacaaccc ctcagaacTC CGAAACCTGG 901 TGAATAAGCA CAGTGAAACC TTCACTCGCG ATAACAACAT GGGGCTGGTG AAGCAATGCT 961 TGTCATCTCT TTATAAGAAG AATATTCAGA GGCTAACAAA GACCTTTTTA ACTCTATCAT 1021 TACAAGATAT GGCAAGTCGT GTGCAGTTGT CTGGACCTCA GGAGGCAGAG AAATACGTTC 1081 TGCACATGAT AGAAGATGGT GAGATTTTTG CAAGTATTAA CCAGAAGGAC GGTATGGTCA 1141 GTTTCCATGA TAACCCTGAA AAATATAATA ACCCAGCCAT GCTTCATAAC ATTGATCAGG 1201 AGATGCTGAA GTGCATTGAG CTGGATGAGC GGCTGAAAGC CATGGACCAG GAGATCACAG 1261 TGAACCCTCA GTTTGTACAA AAGAGTATGG GCTCACAAGA AGATGATTCA GGAAACAAAC 1321 CATCCAGTTA TTCTTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1381 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1441 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CCGCCCGACG ACAGACGTAC 1501 GTTAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt