Construct: ORF TRCN0000472074
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016365.1_s317c1
- Derived from:
- ccsbBroadEn_02412
- DNA Barcode:
- AAAAATGATCTGTAGGGATCGCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CACNG2 (10369)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472074
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10369 | CACNG2 | calcium voltage-gated chann... | NM_006078.4 | 100% | 100% | |
2 | human | 10369 | CACNG2 | calcium voltage-gated chann... | XM_017028531.2 | 72.1% | 67.7% | (many diffs) |
3 | mouse | 12300 | Cacng2 | calcium channel, voltage-de... | NM_007583.2 | 93.9% | 98.7% | (many diffs) |
4 | mouse | 12300 | Cacng2 | calcium channel, voltage-de... | XM_006520371.2 | 86.8% | 91.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1035
- ORF length:
- 969
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gctgtttgat cgaggtgttc aaatgctttt aaccaccgtt ggtgctttcg 121 ctgccttcag cctgatgacc atagctgtgg gaaccgacta ttggctctac tccagagggg 181 tttgcaagac caaaagtgtc agtgagaatg aaaccagcaa aaagaacgag gaagttatga 241 cccattccgg attatggaga acctgctgcc tagaagggaa tttcaaaggt ctgtgcaagc 301 aaattgatca cttcccagag gatgcagatt acgaagctga cacagcagaa tatttcctcc 361 gggccgtgag ggcctccagc attttcccaa tcctgagtgt gattctgctt ttcatgggtg 421 gcctctgcat cgcagccagc gagttctaca aaactcgaca caacatcatc ctgagtgccg 481 gcatcttctt cgtgtctgca ggtctgagta acatcattgg catcatagtg tacatatctg 541 ccaatgccgg agacccctcc aagagcgact ccaaaaagaa tagttactca tacggctggt 601 ccttctactt cggggccctg tccttcatca tcgccgagat ggtcggggtg ctggcggtgc 661 acatgtttat cgaccggcac aaacagctgc gggccacggc ccgcgccacg gactacctcc 721 aggccTCTGC CATCACCCGC ATCCCCAGCT ACCGCTACCG CTACCAGCGC CGCAGCCGCT 781 CCAGCTCGCG CTCCACGGAG CCCTCACACT CCAGGGACGC CTCCCCCGTG GGCATCAAGG 841 GCTTCAACAC CCTGCCGTCC ACGGAGATCT CCATGTACAC GCTCAGCAGG GACCCCCTGA 901 AGGCCGCCAC CACGCCCACC GCCACCTACA ACTCCGACAG GGATAACAGC TTCCTCCAGG 961 TTCACAACTG TATCCAGAAG GAGAACAAGG ACTCTCTCCA CTCCAACACA GCCAACCGCC 1021 GGACCACCCC CGTATACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1081 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1141 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AAAAATGATC TGTAGGGATC 1201 GCCTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt