Construct: ORF TRCN0000472425
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004754.1_s317c1
- Derived from:
- ccsbBroadEn_01672
- DNA Barcode:
- AGCAGATGCAAACTAATTTTTCTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TIMP2 (7077)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472425
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7077 | TIMP2 | TIMP metallopeptidase inhib... | NM_003255.5 | 100% | 100% | |
2 | mouse | 21858 | Timp2 | tissue inhibitor of metallo... | NM_011594.3 | 91.9% | 98.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 726
- ORF length:
- 660
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg cgccgcggcc cgcaccctgc ggctggcgct cggcctcctg ctgctggcga 121 cgctgcttcg cccggccgac gcctgcagct gctccccggt gcacccgcaa caggcgtttt 181 gcaatgcaga tgtagtgatc agggccaaag cggtcagtga gaaggaagtg gactctggaa 241 acgacattta tggcaaccct atcaagagga tccagtatga gatcaagcag ataaagatgt 301 tcaaagggcc tgagaaggat atagagttta tctacacggc cccctcctcg gcagtgtgtg 361 gggtctcgct ggacgttgga ggaaagaagg aatatctcat tgcaggaaag gccgaggggg 421 acggcaagat gcacatcacc ctctgtgact tcatcgtgcc ctgggacacc ctgagcacca 481 cccagaagaa gagcctgaac cacaggtacc agatgggctg cgagtgcaag atcacgcgct 541 gccccatgat cccgtgctac atctcctccc cggacgagtg cctctGGATG GACTGGGTCA 601 CAGAGAAGAA CATCAACGGG CACCAGGCCA AGTTCTTCGC CTGCATCAAG AGAAGTGACG 661 GCTCCTGTGC GTGGTACCGC GGCGCGGCGC CCCCCAAGCA GGAGTTTCTC GACATCGAGG 721 ACCCATACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 781 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 841 CTTGGCTTTA TATATCTTGT GGAAAGGACG AAGCAGATGC AAACTAATTT TTCTAACGCG 901 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt