Construct: ORF TRCN0000472594
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000792.1_s317c1
- Derived from:
- ccsbBroadEn_08338
- DNA Barcode:
- TCGTACAACTCTCCGGAATAGTCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- SELENOT (51714)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472594
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51714 | SELENOT | selenoprotein T | NM_016275.5 | 99.4% | 93.7% | 46C>T;54G>T;76G>A |
| 2 | mouse | 69227 | Selenot | selenoprotein T | NM_001040396.3 | 94.7% | 91.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 210
- ORF length:
- 144
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gcttctgctg cttctcctag tggcggcgtc tgcgatggtc tggagcgatg 121 cctcggccaa tctgggcggc atgcccagca agagattaaa gatgcagtac gccacggggc 181 cgctgctcaa gttccagatt tgtgtttcct gaggttatag gcgggtgttt gaggagtaca 241 tgcgggttat tagccagcgg tacccagaca tccgcattga aggagagaat tacctccctc 301 aaccaatata tagacacata gcatctttcc tgtcagtctt caaactagta ttaataggct 361 taataattgt tggcaaggat ccttttgctt tctttggcat gcaagctcct agcatctggc 421 agtggggcca agaaaataag gtttatgcat gtatgatggt tttcttcttg agcaacatga 481 ttgagaacca gtgtatgtca acaggtgcat ttgagataac tttaaatgat gtacctgtgt 541 ggtcTAAGCT GGAATCTGGT CACCTTCCAT CCATGCAACA ACTTGTTCAA ATTCTTGACA 601 ATGAAATGAA GCTCAATGTG CATATGGATT CAATCCCACA CCATCGATCA TACCCAACTT 661 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 721 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 781 CTTGTGGAAA GGACGATCGT ACAACTCTCC GGAATAGTCC ACGCGTTAAG TCgacaatca 841 acctctggat tacaaaattt gtgaaagatt