Construct: ORF TRCN0000472923
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009397.1_s317c1
- Derived from:
- ccsbBroadEn_02128
- DNA Barcode:
- TGCACACCTACATTCCAACTAGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR55 (9290)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472923
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9290 | GPR55 | G protein-coupled receptor 55 | NM_005683.4 | 100% | 100% | |
| 2 | human | 9290 | GPR55 | G protein-coupled receptor 55 | XM_005246952.4 | 100% | 100% | |
| 3 | human | 9290 | GPR55 | G protein-coupled receptor 55 | XM_011512175.3 | 100% | 100% | |
| 4 | human | 9290 | GPR55 | G protein-coupled receptor 55 | XM_011512176.2 | 100% | 100% |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1023
- ORF length:
- 957
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tcagcaaaac accagtgggg actgcctgtt tgacggtgtc aacgagctga 121 tgaaaaccct acagtttgca gtccacatcc ccaccttcgt cctgggcctg ctcctcaacc 181 tgctggccat ccatggcttc agcaccttcc ttaagaacag gtggcccgat tatgctgcca 241 cctccatcta catgatcaac ctggcagtct ttgacctgct gctggtgctc tccctcccat 301 tcaagatggt cctgtcccag gtacagtccc ccttcccgtc cctgtgcacc ctggtggagt 361 gcctttactt cgtcagcatg tacggaagcg tcttcaccat ctgcttcatc agcatggacc 421 ggttcttggc catccgttac ccgctactgg tgagccacct ccggtccccc aggaagatct 481 ttgggatctg ctgcaccatc tgggtccTGG TGTGGACCGG AAGCATCCCT ATCTACAGTT 541 TCCATGGGAA AGTGGAAAAA TACATGTGCT TCCACAACAT GTCTGATGAT ACCTGGAGCG 601 CCAAGGTCTT CTTCCCGCTG GAGGTGTTTG GCTTCCTCCT TCCCATGGGC ATCATGGGCT 661 TCTGCTGCTC CAGGAGCATC CACATCCTGC TGGGCCGCCG AGACCACACC CAGGACTGGG 721 TGCAGCAGAA AGCCTGCATC TACAGCATCG CAGCCAGCCT GGCTGTCTTC GTGGTCTCCT 781 TCCTCCCAGT CCACCTGGGG TTCTTCCTGC AGTTCCTGGT GAGAAACAGC TTTATCGTAG 841 AGTGCAGAGC CAAGCAGAGC ATCAGCTTCT TCTTGCAATT GTCCATGTGT TTCTCCAACG 901 TCAACTGCTG CCTGGATGTT TTCTGCTACT ACTTTGTCAT CAAAGAATTC CGCATGAACA 961 TCAGGGCCCA CCGGCCTTCC AGGGTCCAGC TGGTCCTGCA GGACACCACG ATCTCCCGGG 1021 GCTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1081 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1141 GGCTTTATAT ATCTTGTGGA AAGGACGATG CACACCTACA TTCCAACTAG TTACGCGTTA 1201 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt