Construct: ORF TRCN0000473105
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012015.1_s317c1
- Derived from:
- ccsbBroadEn_14153
- DNA Barcode:
- AAATAAGGCTTCCCTGGAACATCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CYB5R2 (51700)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473105
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | NM_001302827.1 | 93.8% | 79.3% | (many diffs) |
| 2 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XM_024448581.1 | 86.5% | 82.4% | (many diffs) |
| 3 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | NM_001302826.2 | 83.4% | 79.4% | (many diffs) |
| 4 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | NM_016229.5 | 83.4% | 79.4% | (many diffs) |
| 5 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XM_005252975.5 | 83.4% | 79.4% | (many diffs) |
| 6 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XM_006718251.3 | 83.4% | 79.4% | (many diffs) |
| 7 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XM_024448580.1 | 83.4% | 79.4% | (many diffs) |
| 8 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XM_017017922.1 | 82.4% | 77.9% | (many diffs) |
| 9 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XM_024448582.1 | 82.4% | 77.9% | (many diffs) |
| 10 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XM_011520185.3 | 70.9% | 67.5% | (many diffs) |
| 11 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XM_011520184.2 | 68.5% | 65.2% | (many diffs) |
| 12 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XM_017017920.1 | 68.5% | 65.2% | (many diffs) |
| 13 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XM_017017921.1 | 65.7% | 62.3% | (many diffs) |
| 14 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | NR_126508.2 | 52% | (many diffs) | |
| 15 | human | 51700 | CYB5R2 | cytochrome b5 reductase 2 | XR_002957151.1 | 19.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 777
- ORF length:
- 711
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ctccaggagg agagagccaa tcaccttaca ggaccctgaa gccaagtacc 121 cgctgccctt gattgagaaa gagaaaatca gccacaacac ccggaggttc cgctttggac 181 tgccttcgcc ggaccatgtc ttagggcttc ctgtaggtaa ctatgtccag ctcttggcaa 241 aaatcgataa tgaattggtg gtcagggctt acacccctgt ctccagtgat gatgacagag 301 gctttgtgga cctaattata aagatctact tcaaaaatgt acacccccaa tatcctgaag 361 gtgggaagat gactcagtat ttggagaaca tgaaaatcgg ggagaccaTC TTTTTTCGAG 421 GGCCAAGGGG ACGCTTGTTT TACCATGGGC CAGGGAATCT TGGAATCAGA CCAGACCAGA 481 CGAGTGAGCC TAAAAAAACA CTGGCCGATC ACCTGGGAAT GATTGCTGGG GGCACAGGCA 541 TCACACCCAT GTTGCAGCTC ATTCGCCACA TCACCAAGGA CCCCAGTGAC AGGACCAGGA 601 TGTCCCTCAT CTTTGCCAAC CAGACAGAGG AGGATATCTT GGTCAGAAAA GAGCTTGAAG 661 AAATTGCCAG GACTCACCCA GACCAGTTCG ACCTGTGGTA CACCCTGGAC AGGCCTCCCA 721 TTGGTCCCTG GTCGGCAGAG GGCGCTACCC TACTGAGCAA TTCTGCGCAG TTCCACTACC 781 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 841 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 901 ATATATCTTG TGGAAAGGAC GAAAATAAGG CTTCCCTGGA ACATCCACGC GTTAAGTCga 961 caatcaacct ctggattaca aaatttgtga aagatt