Construct: ORF TRCN0000474080
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001878.1_s317c1
- Derived from:
- ccsbBroadEn_08319
- DNA Barcode:
- CACAGTGTATTCAGCTTTCAAACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MBIP (51562)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474080
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51562 | MBIP | MAP3K12 binding inhibitory ... | NM_001144891.1 | 99.7% | 99.1% | 5C>G;20T>A;66A>C |
| 2 | human | 51562 | MBIP | MAP3K12 binding inhibitory ... | NM_016586.3 | 99.4% | 98.8% | (many diffs) |
| 3 | human | 51562 | MBIP | MAP3K12 binding inhibitory ... | XM_005267754.4 | 93% | 92.4% | (many diffs) |
| 4 | human | 51562 | MBIP | MAP3K12 binding inhibitory ... | XM_005267756.5 | 81.6% | 76.6% | (many diffs) |
| 5 | human | 51562 | MBIP | MAP3K12 binding inhibitory ... | NM_001308110.2 | 81.3% | 77.5% | (many diffs) |
| 6 | human | 51562 | MBIP | MAP3K12 binding inhibitory ... | XM_017021367.2 | 75.2% | 70.2% | (many diffs) |
| 7 | human | 51562 | MBIP | MAP3K12 binding inhibitory ... | XR_001750370.2 | 55.2% | (many diffs) | |
| 8 | human | 51562 | MBIP | MAP3K12 binding inhibitory ... | XR_001750371.2 | 55.1% | (many diffs) | |
| 9 | human | 51562 | MBIP | MAP3K12 binding inhibitory ... | XR_001750373.2 | 51.5% | (many diffs) | |
| 10 | mouse | 217588 | Mbip | MAP3K12 binding inhibitory ... | XM_006515673.3 | 86.4% | 81.6% | (many diffs) |
| 11 | mouse | 217588 | Mbip | MAP3K12 binding inhibitory ... | NM_145442.2 | 86.2% | 81.3% | (many diffs) |
| 12 | mouse | 217588 | Mbip | MAP3K12 binding inhibitory ... | XM_017315023.1 | 70.3% | 61.5% | (many diffs) |
| 13 | mouse | 217588 | Mbip | MAP3K12 binding inhibitory ... | XM_006515674.3 | 63.7% | 61.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1095
- ORF length:
- 1029
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tgctgccacg gagcataatc gcccgagcag cggtgacagg aacctggagc 121 gaagatgcag ccccaacctc tcccgagagg tgctctacga aatctttcgc tccctacaca 181 ccctggttgg acagcttgac ctcagagatg atgtggtgaa aattacaatc gattggaaca 241 agctccagag cctctcggca ttccagcctg cattgctctt tagtgcactt gaacaacaca 301 ttttatattt acagcctttt ttagcaaaac ttcagtctcc gattaaagag gagaatacaa 361 ctgctgttga agagatagga agaacagaaa tggggaacaa aaatgaagta aatgacaaat 421 tttccattgg cgacctacaa gaggaagaaa agcacaaaga aagtgattta agagatgtga 481 aaaagacaca gatccatttt gatccagaag tagttcagat aaaggctgga aaagcagaaa 541 ttgacagacg aatatctgca tttattgaaa gaaagcaagc tgaaatcaat gaaaacaacg 601 tcagggaatt ttgcaatgtt attgattgta atcaagaaaa tagttgtgca agaactgatg 661 cgatttttac cccttacccc ggatttaaaa gtcacgtaaa agtttctaga gttgtgaata 721 catacggacc acagactaga cctgaaggaa ttccagggtc aggtcataaa cctaacagca 781 tgcttcgaga ctgtggtaat caggctgtag aagaacgact acaaaatatt gaggcccact 841 tgcggttaca gacaggtggt ccagtgccaa gagacattta tcagagaatt aaaaaacttg 901 aggataaaat ccttgaattg gaaggcatct cTCCTGAATA TTTTCAGTCT GTAAGCTTTT 961 CTGGAAAAAG AAGAAAAGTT CAACCACCTC AAAACTATTC ACTGGCTGAA CTTGATGAGA 1021 AAATTAGTGC CCTCAAACAA GCCCTCCTCA GAAAATCAAG AGAAGCAGAA TCCATGGCAA 1081 CCCACCACCT TCCATGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1141 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1201 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CACAGTGTAT TCAGCTTTCA 1261 AACAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt