Construct: ORF TRCN0000474313
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016073.1_s317c1
- Derived from:
- ccsbBroadEn_07422
- DNA Barcode:
- AGCAGAACTTCTATACATGGCCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EIF4E2 (9470)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474313
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) | Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) | Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9470 | EIF4E2 | eukaryotic translation init... | NM_004846.4 | 99.7% | 99.5% | 20C>G;735A>G | 
| 2 | human | 9470 | EIF4E2 | eukaryotic translation init... | NM_001330202.1 | 97.8% | 97.1% | 4_5insACAACAAGTTCGACG;720A>G | 
| 3 | human | 9470 | EIF4E2 | eukaryotic translation init... | NM_001282958.1 | 94% | 87.4% | (many diffs) | 
| 4 | human | 9470 | EIF4E2 | eukaryotic translation init... | NM_001276336.1 | 91.4% | 90.2% | (many diffs) | 
| 5 | human | 9470 | EIF4E2 | eukaryotic translation init... | NM_001330201.1 | 81.3% | 81.2% | 20C>G;135_136ins135;600A>G | 
| 6 | human | 9470 | EIF4E2 | eukaryotic translation init... | NM_001330203.1 | 75.7% | 69.8% | (many diffs) | 
| 7 | human | 9470 | EIF4E2 | eukaryotic translation init... | NM_001276337.1 | 73.3% | 71.8% | (many diffs) | 
| 8 | mouse | 26987 | Eif4e2 | eukaryotic translation init... | NM_001039170.1 | 93.4% | 97.9% | (many diffs) | 
| 9 | mouse | 26987 | Eif4e2 | eukaryotic translation init... | NM_001039169.1 | 91.5% | 95.5% | (many diffs) | 
| 10 | mouse | 26987 | Eif4e2 | eukaryotic translation init... | NM_001347083.1 | 87.9% | 85.8% | (many diffs) | 
| 11 | mouse | 26987 | Eif4e2 | eukaryotic translation init... | XM_006529670.3 | 87.9% | 85.8% | (many diffs) | 
| 12 | mouse | 26987 | Eif4e2 | eukaryotic translation init... | NM_023314.3 | 85.4% | 88.5% | (many diffs) | 
| 13 | mouse | 26987 | Eif4e2 | eukaryotic translation init... | XM_006529674.3 | 85% | 84.6% | (many diffs) | 
| 14 | mouse | 26987 | Eif4e2 | eukaryotic translation init... | XM_006529673.1 | 84.2% | 87.4% | (many diffs) | 
| 15 | mouse | 26987 | Eif4e2 | eukaryotic translation init... | XM_006529669.1 | 82.4% | 85% | (many diffs) | 
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 801
- ORF length:
- 735
- Sequence:
- 
          1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa caacaagttc gacggtttga aagatgatga cagtggggac catgatcaga 121 atgaagaaaa cagcacacag aaagatggtg agaaggaaaa aacggaacga gacaagaatc 181 agagcagtag caagagaaag gctgttgtcc ctggaccggc agagcatccc ctgcagtaca 241 actacacttt ttggtactcc aggagaaccc ccggccgtcc cacgagctca cagagctatg 301 aacagaatat caaacagatt ggcacctttg cctctgtgga gcagttctgg aggttttata 361 gccacatggt acgtcctggg gaccTGACAG GCCACAGTGA CTTCCATCTC TTCAAAGAAG 421 GAATTAAACC CATGTGGGAG GATGATGCAA ATAAAAATGG TGGCAAGTGG ATTATTCGGC 481 TGCGGAAGGG CTTGGCCTCC CGTTGCTGGG AGAATCTCAT TTTGGCCATG CTGGGGGAAC 541 AGTTCATGGT TGGGGAGGAG ATCTGTGGGG CTGTGGTGTC TGTCCGCTTT CAGGAAGACA 601 TTATTTCAAT ATGGAATAAG ACTGCCAGTG ACCAAGCAAC CACAGCCCGA ATCCGGGACA 661 CACTTCGGCG AGTGCTTAAC CTACCTCCCA ACACCATTAT GGAATACAAA ACTCACACCG 721 ACAGCATCAA AATGCCAGGC AGGCTGGGCC CCCAAAGGCT CCTTTTTCAA AACCTCTGGA 781 AGCCGCGGTT GAATGTGCCG TGCCGAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 841 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 901 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAGCA GAACTTCTAT 961 ACATGGCCAT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt 
 
 
              