Construct: ORF TRCN0000474690
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012356.1_s317c1
- Derived from:
- ccsbBroadEn_09660
- DNA Barcode:
- CGATCTATGGCACGACCATTTGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MOB3C (148932)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474690
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 148932 | MOB3C | MOB kinase activator 3C | NM_201403.2 | 99.6% | 99.5% | 357A>G;539C>A |
2 | human | 148932 | MOB3C | MOB kinase activator 3C | NM_145279.4 | 80.3% | 80.2% | 1_156del;513A>G;695C>A |
3 | mouse | 100465 | Mob3c | MOB kinase activator 3C | NM_175308.4 | 89.8% | 97.2% | (many diffs) |
4 | mouse | 100465 | Mob3c | MOB kinase activator 3C | XM_011240381.1 | 89.8% | 97.2% | (many diffs) |
5 | mouse | 100465 | Mob3c | MOB kinase activator 3C | XM_011240382.2 | 89.8% | 97.2% | (many diffs) |
6 | mouse | 100465 | Mob3c | MOB kinase activator 3C | XM_011240380.1 | 57.9% | 62.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 714
- ORF length:
- 648
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cctgtgcctg aagcaggtgt tcgccaagga caagacgttc cggccgcgga 121 agcgctttga gccgggcaca cagcgctttg agctgtacaa gaaggcacag gcctctctca 181 agtcgggcct ggacctgcgc agtgtggtga ggctaccacc cggggagaac atcgacgact 241 ggatcgccgt gcacgtggtg gacttcttca accgcatcaa cctcatctac ggcactatgg 301 cggagcgctg cagtgagacc agctgcccgg tcatggccgg cgggccccgc tacgagtacc 361 gctggcagga cgagcgccag taccggcggc ccgccaagct ctctgcgccg cgctatatgg 421 cgttgctcat ggactggatc gaaggcctca tcaacgacga agaggtcttt cccacgcgtg 481 ttggagttcc cttccctaag aacttccagc aggtctgcac caagatcctg acccgcctct 541 tccgagtctt tgtccatgtc tacatccacc acttcgatag catcctcagc atgggggcag 601 aggagcacgt caacacctgc tacaagcact tctactactt catccgcgag ttcagtctgg 661 tggaccagcg ggagctGGAG CCACTGAGGG AGATGACAGA GCGGATCTGC CACTGCCCAA 721 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 781 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 841 TATCTTGTGG AAAGGACGAC GATCTATGGC ACGACCATTT GATACGCGTT AAGTCgacaa 901 tcaacctctg gattacaaaa tttgtgaaag att