Construct: ORF TRCN0000474797
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011344.1_s317c1
- Derived from:
- ccsbBroadEn_15795
- DNA Barcode:
- GTAAGAACCTTACATTCAATGATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UBE2S (27338)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474797
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 27338 | UBE2S | ubiquitin conjugating enzym... | NM_014501.3 | 98.6% | 97.7% | (many diffs) |
| 2 | human | 27338 | UBE2S | ubiquitin conjugating enzym... | XM_011526752.2 | 55% | 49.7% | (many diffs) |
| 3 | mouse | 77891 | Ube2s | ubiquitin-conjugating enzym... | NM_133777.2 | 86.3% | 91.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 732
- ORF length:
- 666
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ctccaacgtg gagaacctgc ccccgcacat catccgcctg gtgtacaagg 121 aggtgacgac actgaccgca gacccacccg atggcatcaa ggtctttccc aacgaggagg 181 acctcaccga cctccaggtc accatcgagg gccctgaagg gaccccatat gctggaggtc 241 tgttccgcat gaaactcctg ctggggaagg acttccctgc ctccccaccc aagggctact 301 tcctgaccaa gatcttccac ctgaacgtgg gcgccaatgg cgagatctgc gtcaacgtgc 361 tcaagaggga ctggacggct gagctgggca tccgacacgt actgctgacc aTCAGGTGCC 421 TGCTGATCCA CCCTAACCCC GAGTCTGCAC TCAACGAGGA GGCGGGCCGC CTGCTCTTGG 481 AGAACTCCGA GGAGTATGCG GCCCGGGCCC GTCTGCTCAC AGAGATCCAC GGGGGCGCCG 541 GCGGGCCCAG CGGCAGGGCC GAAGCCGGGC GGGCCCTGGC CAGTGGCACT GCAGCTTCCT 601 CCACCGACCC TGGGGCCCCA GGGGGCCTGG GAGGGGCTGA GGGTCCCATG GCCAAGAAGC 661 ATGCTGGCGA GCGCGATAAG AAGCTGGCGG CCAAGAAAAA GACGGACAAG AAGCGGGCGC 721 TGCGGCGGCT GTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 781 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 841 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGTA AGAACCTTAC ATTCAATGAT 901 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t