Construct: ORF TRCN0000474983
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014077.1_s317c1
- Derived from:
- ccsbBroadEn_04115
- DNA Barcode:
- AACAAGAGTCCAGGAGTTGACGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SUV39H2 (79723)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474983
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NM_001193426.1 | 100% | 100% | |
| 2 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NM_001193427.1 | 73.9% | 73.9% | 0_1ins180 |
| 3 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NM_001193424.2 | 56% | 56% | 308_847del |
| 4 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NM_001193425.1 | 41.4% | 41.4% | 0_1ins180;128_667del |
| 5 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NM_024670.3 | 41.4% | 41.4% | 0_1ins180;128_667del |
| 6 | human | 79723 | SUV39H2 | suppressor of variegation 3... | XM_006717503.3 | 41.4% | 41.4% | 0_1ins180;128_667del |
| 7 | human | 79723 | SUV39H2 | suppressor of variegation 3... | XM_011519662.2 | 41.4% | 41.4% | 0_1ins180;128_667del |
| 8 | human | 79723 | SUV39H2 | suppressor of variegation 3... | XM_017016637.1 | 41.4% | 41.4% | 0_1ins180;128_667del |
| 9 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NR_034181.1 | 19% | (many diffs) | |
| 10 | mouse | 64707 | Suv39h2 | suppressor of variegation 3... | NM_022724.4 | 43.3% | 44% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 756
- ORF length:
- 690
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcggtcggg gccgaggcgc gaggagcttg gtgtgtgcct tgcctagttt 121 cacttgatac tcttcaggaa ttatgtagaa aagaaaagct cacatgtaaa tcgattggaa 181 tcaccaaaag gaatctaaac aattatgagg tggaatactt gtgtgactac aaggtagtaa 241 aggatatgga atattatctt gtaaaatgga aaggatggcc agattctaca aatacttggg 301 aacctttgca aaatctgaag tgcccgttac tgcttcagca attctctaat gacaagcata 361 attatttatc tcaggtaatc acaagtgaag aagctgaaag acgaggacag ttctatgaca 421 acaagggaat cacgtatctc tttgatctgg actatgagtc tgatgaattc acagtggatg 481 cggCTCGATA CGGCAATGTG TCTCATTTTG TGAATCACAG CTGTGACCCA AATCTTCAGG 541 TGTTCAATGT TTTCATTGAT AACCTCGATA CTCGTCTTCC CCGAATAGCA TTGTTTTCCA 601 CAAGAACCAT AAATGCTGGA GAAGAGCTGA CTTTTGATTA TCAAATGAAA GGTTCTGGAG 661 ATATATCTTC AGATTCTATT GACCACAGCC CAGCCAAAAA GAGGGTCAGA ACAGTATGTA 721 AATGTGGAGC TGTGACTTGC AGAGGTTACC TCAACTGCCC AACTTTCTTG TACAAAGTGG 781 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 841 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 901 AAACAAGAGT CCAGGAGTTG ACGTCACGCG TTAAGTCgac aatcaacctc tggattacaa 961 aatttgtgaa agatt