Construct: ORF TRCN0000475077
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007315.1_s317c1
- Derived from:
- ccsbBroadEn_04978
- DNA Barcode:
- CTTGAGGAGTCGGGCTGAGTTCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HAPLN3 (145864)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475077
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 145864 | HAPLN3 | hyaluronan and proteoglycan... | NM_178232.4 | 100% | 100% | |
| 2 | human | 145864 | HAPLN3 | hyaluronan and proteoglycan... | XM_011521261.1 | 89.1% | 89.1% | 1_132del |
| 3 | human | 145864 | HAPLN3 | hyaluronan and proteoglycan... | NM_001307952.2 | 85.3% | 85.3% | 1_186del |
| 4 | human | 145864 | HAPLN3 | hyaluronan and proteoglycan... | XM_017021935.2 | 61.5% | 58.3% | 0_1ins379;114_171del |
| 5 | human | 145864 | HAPLN3 | hyaluronan and proteoglycan... | XM_017021936.2 | 61.5% | 58.3% | 0_1ins379;114_171del |
| 6 | human | 145864 | HAPLN3 | hyaluronan and proteoglycan... | XM_017021934.2 | 61.3% | 61.3% | 1_186del;677_678ins303 |
| 7 | human | 145864 | HAPLN3 | hyaluronan and proteoglycan... | XR_001751098.2 | 50.3% | 1_333del;826_876del;1465_2143del | |
| 8 | human | 145864 | HAPLN3 | hyaluronan and proteoglycan... | XR_931756.3 | 32.8% | 1_334del;827_2019del;2608_3286del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1146
- ORF length:
- 1080
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg cctgttgctc ctggtcccgt tgctcctgct gcccggctcc tacggactgc 121 ccttctacaa cggcttctac tactccaaca gcgccaacga ccagaaccta ggcaacggtc 181 atggcaaaga cctccttaat ggagtgaagc tggtggtgga gacacccgag gagaccctgt 241 tcacctacca aggggccagt gtgatcctgc cctgccgcta ccgctacgag ccggccctgg 301 tctccccgcg gcgtgtgcgt gtcaaatggt ggaagctgtc ggagaacggg gccccagaga 361 aggacgtgct ggtggccatc gggctgaggc accgctcctt tggggactac caaggccgcg 421 tgcacctgcg gcaggacaaa gagcatgacg tctcgctgga gatccaggat ctgcggctgg 481 aggactatgg gcgttaccgc tgtgaggtca ttgacgggct ggaggatgaa agcggtctgg 541 tggagctgga gctgcggggt gtggtctttc cttaccagtc ccccaacggg cgctaccagt 601 tcaacttcca cgagggccag caggtctgtg cagagcaggc tgcggtggtg gcctcctttg 661 agcagctctt ccgggcctgg gaggagggcc tggactggtg caacgcgggc tggctgcagg 721 atgccacggt gcagtacccc atcatgttgc cccggcagcc ctgcggtggc ccgggcctgg 781 cacctggcgt gcgaagctac ggcccccgcc accgccgccT GCACCGCTAT GATGTATTCT 841 GCTTCGCTAC TGCCCTCAAG GGGCGGGTGT ACTACCTGGA GCACCCTGAG AAGCTGACGC 901 TGACAGAGGC AAGGGAGGCC TGCCAGGAAG ATGATGCCAC GATCGCCAAG GTGGGACAGC 961 TCTTTGCCGC CTGGAAGTTC CATGGCCTGG ACCGCTGCGA CGCTGGCTGG CTGGCAGATG 1021 GTAGCGTCCG CTACCCTGTG GTTCACCCGC ATCCTAACTG TGGGCCCCCA GAGCCTGGGG 1081 TCCGAAGCTT TGGCTTCCCC GACCCGCAGA GCCGCTTGTA CGGTGTTTAC TGCTACCGCC 1141 AGCACTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1201 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1261 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACTTGAGGAG TCGGGCTGAG TTCACACGCG 1321 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt