Construct: ORF TRCN0000475178
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015365.1_s317c1
- Derived from:
- ccsbBroadEn_06716
- DNA Barcode:
- GATTGGATGAATGGCCCCCCTACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PFKM (5213)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475178
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_000289.6 | 99.9% | 100% | 2334T>G |
2 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001166687.1 | 99.9% | 100% | 2334T>G |
3 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001166688.1 | 99.9% | 100% | 2334T>G |
4 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354742.1 | 99.9% | 100% | 2334T>G |
5 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354743.1 | 99.9% | 100% | 2334T>G |
6 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354744.1 | 99.9% | 100% | 2334T>G |
7 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_024449022.1 | 99.9% | 100% | 2334T>G |
8 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354741.1 | 98.9% | 98.9% | 1_24del;2358T>G |
9 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354745.1 | 96.2% | 96.2% | 0_1ins87;2247T>G |
10 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001363619.1 | 95.9% | 96% | 843_844ins93;2241T>G |
11 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_024449021.1 | 95.8% | 95.9% | 1_99del;2433T>G |
12 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354746.1 | 94.5% | 94.6% | 934_935ins126;2208T>G |
13 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354740.1 | 94.1% | 94.2% | 1_144del;2478T>G |
14 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354747.1 | 93.4% | 93.2% | (many diffs) |
15 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354748.1 | 93.4% | 93.2% | (many diffs) |
16 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001166686.2 | 91.6% | 91.6% | 1_213del;2547T>G |
17 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354737.1 | 91.6% | 91.6% | 1_213del;2547T>G |
18 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354738.1 | 91.6% | 91.6% | 1_213del;2547T>G |
19 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354739.1 | 91.6% | 91.6% | 1_213del;2547T>G |
20 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_005268979.1 | 91.6% | 91.6% | 1_213del;2547T>G |
21 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_024449020.1 | 91.2% | 91.3% | 1_222del;2556T>G |
22 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354735.1 | 88.2% | 88.3% | 1_309del;2643T>G |
23 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354736.1 | 88.2% | 88.3% | 1_309del;2643T>G |
24 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_005268974.1 | 88.2% | 88.3% | 1_309del;2643T>G |
25 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_005268976.3 | 88.2% | 88.3% | 1_309del;2643T>G |
26 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_017019469.1 | 87.9% | 88% | 1_213del;1056_1057ins93;2454T>G |
27 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_011538487.1 | 84.7% | 84.8% | 1_309del;1152_1153ins93;2550T>G |
28 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148958.1 | 69.2% | (many diffs) | |
29 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148954.1 | 67.2% | (many diffs) | |
30 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148959.1 | 67% | (many diffs) | |
31 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148956.1 | 65.1% | (many diffs) | |
32 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148957.1 | 64.4% | (many diffs) | |
33 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148955.1 | 56.8% | (many diffs) | |
34 | mouse | 18642 | Pfkm | phosphofructokinase, muscle | NM_001163487.1 | 90.1% | 97.8% | (many diffs) |
35 | mouse | 18642 | Pfkm | phosphofructokinase, muscle | NM_001163488.1 | 90.1% | 97.8% | (many diffs) |
36 | mouse | 18642 | Pfkm | phosphofructokinase, muscle | NM_021514.4 | 90.1% | 97.8% | (many diffs) |
37 | mouse | 18642 | Pfkm | phosphofructokinase, muscle | XM_006520602.2 | 90.1% | 97.8% | (many diffs) |
38 | mouse | 18642 | Pfkm | phosphofructokinase, muscle | XM_006520601.3 | 82.7% | 89.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2406
- ORF length:
- 2340
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ccatgaagag caccatgcag ccaaaaccct ggggattggc aaagccattg 121 ctgtcttaac ctctggtgga gatgcccaag gtatgaatgc tgctgtcagg gctgtggttc 181 gagttggtat cttcaccggt gcccgtgtct tctttgtcca tgagggttat caaggcctgg 241 tggatggtgg agatcacatc aaggaagcca cctgggagag cgtttcgatg atgcttcagc 301 tgggaggcac ggtgattgga agtgcccggt gcaaggactt tcgggaacga gaaggacgac 361 tccgagctgc ctacaacctg gtgaagcgtg ggatcaccaa tctctgtgtc attgggggtg 421 atggcagcct cactggggct gacaccttcc gttctgagtg gagtgacttg ttgagtgacc 481 tccagaaagc aggtaagatc acagatgagg aggctacgaa gtccagctac ctgaacattg 541 tgggcctggt tgggtcaatt gacaatgact tctgtggcac cgatatgacc attggcactg 601 actctgccct gcatcggatc atggaaattg tagatgccat cactaccact gcccagagcc 661 accagaggac atttgtgtta gaagtaatgg gccgccactg tggatacctg gcccttgtca 721 cctctctgtc ctgtggggcc gactgggttt ttattcctga atgtccacca gatgacgact 781 gggaggaaca cctttgtcgc cgactcagcg agacaaggac ccgtggttct cgtctcaaca 841 tcatcattgt ggctgagggt gcaattgaca agaatggaaa accaatcacc tcagaagaca 901 tcaagaatct ggtggttaag cgtctgggat atgacacccg ggttactgtc ttggggcatg 961 tgcagagggg tgggacgcca tcagcctttg acagaattct gggcagcagg atgggtgtgg 1021 aagcagtgat ggcacttttg gaggggaccc cagatacccc agcctgtgta gtgagcctct 1081 ctggtaacca ggctgtgcgc ctgcccctca tggaatgtgt ccaggtgacc aaagatgtga 1141 ccaaggccat ggatgagaag aaatttgacg aagccctgaa gctgagaggc cggagcttca 1201 tgaacaactg ggaggtgtac aagcttctag ctcatgtcag acccccggta tctaagagtg 1261 gttcgcacac agtggctgtg atgaacgtgg gggctccggc tgcaggcatg aatgctgctg 1321 ttcgctccac tgtgaggatt ggccttatcc agggcaaccg agtgctcgtt gtccatgatg 1381 gtttcgaggg cctggccaag gggcagatag aggaagctgg ctggagctat gttgggggct 1441 ggactggcca aggtggctct aaacttggga ctaaaaggac tctacccaag aagagctttg 1501 aacagatcag tgccaatata actaagttta acattcaggg ccttgtcatc attgggggct 1561 ttgaggctta cacagggggc ctggaactga tggagggcag gaagcagttt gatgagctct 1621 gcatcccatt tgtggtcatt cctgctacag tctccaacaa tgtccctggc tcagacttca 1681 gcgttggggc tgacacagca ctcaatacta tctgcacaac ctgtgaccgc atcaagcagt 1741 cagcagctgg caccaagcgt cgggtgttta tcattgagac tatgggtggc tactgtggct 1801 acctggctac catggctgga ctggcagctg gggccgatgc tgcctacatt tttgaggagc 1861 ccttcaccat tcgagacctg caggcaaatg ttgaacatct ggtgcaaaag atgaaaacaa 1921 ctgtgaaaag gggcttggtg ttaaggaatg aaaagtgcaa tgagaactat accactgact 1981 tcattttcaa cctgtactct gaggagggga agggcaTCTT CGACAGCAGG AAGAATGTGC 2041 TTGGTCACAT GCAGCAGGGT GGGAGCCCAA CCCCATTTGA TAGGAATTTT GCCACTAAGA 2101 TGGGCGCCAA GGCTATGAAC TGGATGTCTG GGAAAATCAA AGAGAGTTAC CGTAATGGGC 2161 GGATCTTTGC CAATACTCCA GATTCGGGCT GTGTTCTGGG GATGCGTAAG AGGGCTCTGG 2221 TCTTCCAACC AGTGGCTGAG CTGAAGGACC AGACAGATTT TGAGCATCGA ATCCCCAAGG 2281 AACAGTGGTG GCTGAAACTG AGGCCCATCC TCAAAATCCT AGCCAAGTAC GAGATTGACT 2341 TGGACACTTC AGACCATGCC CACCTGGAGC ACATCACCCG GAAGCGGTCC GGGGAAGCGG 2401 CCGTCTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 2461 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 2521 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGATTGGATG AATGGCCCCC CTACGACGCG 2581 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt