Construct: ORF TRCN0000475716
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018299.1_s317c1
- Derived from:
- ccsbBroadEn_01921
- DNA Barcode:
- ATGACAACTAAATAGGTCCATAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SOX14 (8403)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475716
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8403 | SOX14 | SRY-box transcription facto... | NM_004189.4 | 100% | 100% | |
| 2 | mouse | 20669 | Sox14 | SRY (sex determining region... | NM_011440.1 | 95.4% | 99.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 789
- ORF length:
- 720
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtccaaacct tcagaccaca tcaagcggcc catgaacgcc ttcatggtat 121 ggtcccgggg ccagcggcgc aagatggccc aggaaaaccc caagatgcac aactcggaga 181 tcagcaaacg cctaggtgcc gaatggaagc ttctgtccga ggcagagaag cggccataca 241 tcgatgaagc caagcggcta cgcgcccagc acatgaagga gcaccctgac tacaagtacc 301 gacctcggcg caagcccaag aacctgctca agaaggacag gtatgtcttc cccttgccct 361 acctgggcga cacggacccg ctcaaggcgg ctggcctgcc cgtgggggcc tccgacggcc 421 tcctgagcgc gcccgagaaa gcccgggcct tcttgccgcc ggcctcggcg ccctactCCC 481 TGCTGGACCC CGCGCAGTTT AGCTCGAGCG CCATCCAGAA GATGGGCGAA GTGCCCCACA 541 CCTTGGCTAC CGGCGCTCTG CCCTACGCGT CCACCCTGGG CTACCAGAAC GGCGCCTTCG 601 GCAGCCTCAG CTGCCCCAGC CAGCACACGC ACACGCACCC GTCCCCCACC AACCCTGGCT 661 ACGTGGTGCC CTGTAACTGT ACCGCCTGGT CTGCCTCCAC CCTGCAGCCC CCCGTCGCCT 721 ACATCCTCTT CCCAGGCATG ACCAAGACTG GCATAGACCC TTATTCGTCA GCCCACGCTA 781 CGGCCATGTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 841 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 901 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATGACA ACTAAATAGG TCCATAGAAC 961 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt