Construct: ORF TRCN0000476083
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008219.1_s317c1
- Derived from:
- ccsbBroadEn_05372
- DNA Barcode:
- AGGAATTATTCGACTGTTGCGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NEK8 (284086)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476083
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 284086 | NEK8 | NIMA related kinase 8 | NM_178170.3 | 100% | 100% | |
| 2 | mouse | 140859 | Nek8 | NIMA (never in mitosis gene... | NM_080849.3 | 86.9% | 93.4% | (many diffs) |
| 3 | mouse | 140859 | Nek8 | NIMA (never in mitosis gene... | XM_006532184.3 | 86.8% | 93.1% | (many diffs) |
| 4 | mouse | 140859 | Nek8 | NIMA (never in mitosis gene... | XM_006532183.3 | 85.6% | 91.8% | (many diffs) |
| 5 | mouse | 140859 | Nek8 | NIMA (never in mitosis gene... | XM_006532185.3 | 79.9% | 85.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2145
- ORF length:
- 2076
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagaagtac gagcggatcc gagtggtggg gagaggtgcc ttcgggattg 121 tgcacctgtg cctgcgaaag gctgaccaga agctggtgat catcaagcag attccagtgg 181 aacagatgac caaggaagag cggcaggcag cccagaatga gtgccaggtc ctcaagctgc 241 tcaaccaccc caatgtcatt gagtactacg agaacttcct ggaagacaaa gcccttatga 301 tcgccatgga atatgcacca ggcggcactc tggctgagtt catccaaaag cgctgtaatt 361 ccctgctgga ggaggagacc atcctgcact tcttcgtgca gatcctgctt gcactgcatc 421 atgtgcacac ccacctcatc ctgcaccgag acctcaagac ccagaacatc ctgcttgaca 481 aacaccgcat ggtcgtcaag atcggtgatt tcggcatctc caagatcctt agcagcaaga 541 gcaaggccta cacggtggtg ggtaccccat gctatatctc ccctgagctg tgtgagggca 601 agccctacaa ccagaagagt gacatctggg ccctgggctg tgtcctctac gagctggcca 661 gcctcaagag ggctttcgag gctgcgaact tgccagcact ggtgctgaag atcatgagtg 721 gcacctttgc acctatctct gaccggtaca gccctgagct tcgccagctg gtcctgagtc 781 tactcagcct ggagcctgcc cagcggccac cactcagcca catcatggca cagcccctct 841 gcatccgtgc cctcctcaac ctccacaccg acgtgggcag tgtccgcatg cggagggcag 901 agaagtccgt ggcccccagc aacacaggga gcaggaccac cagtgtccgc tgcagaggta 961 tcccccgggg acctgtgagg ccagccatcc caccaccact gtcgtcagtg tatgcctggg 1021 gtggtgggct gggcaccccc ctgcggctgc caatgctcaa cacagaggtg gtccaggtgg 1081 cagctgggcg cacgcagaaa gccggcgtca cgcgctctgg gcgtctcatc ctgtgggagg 1141 ccccacccct aggtgcaggc ggaggcagtc tccttcctgg ggcagtggag cagccacagc 1201 cccagttcat ctcgcgtttc ctggagggcc agtcgggtgt gaccatcaag cacgtggcct 1261 gtggggactt cttcactgcc tgcctgactg acagaggcat catcatgaca ttcggcagcg 1321 gcagcaatgg gtgcctaggc catggcagcc tcactgacat cagccagccc accattgtgg 1381 aggctttgct gggctatgaa atggtgcagg tggcctgtgg ggcctctcac gtgctggccc 1441 tgtccactga gcgagaacta tttgcctggg gccgtggaga cagcggcaga ctggggctag 1501 gcaccaggga gtcccacagc tgcccccagc aggtgcccat gcccccagga caggaagctc 1561 agcgagttgt atgtggtatc gattcctcca tgatcctcac tgtgcctggc caagccctag 1621 cctgtgggag caacaggttc aacaagctgg gcctggacca cctctccctg ggggaggagc 1681 ctgtccccca ccagcaagtg gaggaggccc tgagcttcac actactaggc tctgcacccc 1741 tggaccagga gcctctgctg agtatagacc tgggcactgc tcactcagct gctgtgactg 1801 cctcgggtga ttgcTACACT TTTGGCAGCA ATCAGCACGG ACAGTTGGGC ACCAATACTC 1861 GCCGAGGCAG TCGGGCACCC TGTAAGGTCC AAGGCCTTGA GGGCATCAAG ATGGCAATGG 1921 TAGCCTGTGG GGATGCCTTC ACTGTAGCTA TTGGGGCAGA GAGCGAAGTG TACTCTTGGG 1981 GCAAAGGGGC GCGAGGTCGA TTGGGAAGGA GGGATGAGGA TGCCGGACTC CCTCGGCCAG 2041 TGCAGTTGGA TGAGACACAC CCTTACACGG TGACTTCCGT GTCCTGTTGC CATGGAAACA 2101 CCCTCCTGGC TGTTCGATCG GTCACAGATG AGCCGGTCCC CCCCTTGCCA ACTTTCTTGT 2161 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 2221 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 2281 GAAAGGACGA AGGAATTATT CGACTGTTGC GCCAACGCGT TAAGTCgaca atcaacctct 2341 ggattacaaa atttgtgaaa gatt