Construct: ORF TRCN0000476252
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008030.1_s317c1
- Derived from:
- ccsbBroadEn_00598
- DNA Barcode:
- CAACCCTACGTTACGTTATCCTGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FUT3 (2525)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476252
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2525 | FUT3 | fucosyltransferase 3 (Lewis... | NM_000149.3 | 100% | 100% | |
2 | human | 2525 | FUT3 | fucosyltransferase 3 (Lewis... | NM_001097639.2 | 99.8% | 99.4% | 202C>T;314T>C |
3 | human | 2525 | FUT3 | fucosyltransferase 3 (Lewis... | NM_001097640.2 | 99.8% | 99.4% | 202C>T;314T>C |
4 | human | 2525 | FUT3 | fucosyltransferase 3 (Lewis... | NM_001097641.2 | 99.8% | 99.4% | 202C>T;314T>C |
5 | human | 2525 | FUT3 | fucosyltransferase 3 (Lewis... | XM_011527865.1 | 99.8% | 99.4% | 202C>T;314T>C |
6 | human | 2525 | FUT3 | fucosyltransferase 3 (Lewis... | XM_011527866.1 | 99.8% | 99.4% | 202C>T;314T>C |
7 | human | 2525 | FUT3 | fucosyltransferase 3 (Lewis... | XM_011527867.1 | 99.8% | 99.4% | 202C>T;314T>C |
8 | human | 2527 | FUT5 | fucosyltransferase 5 | NM_002034.2 | 90.9% | 88.2% | (many diffs) |
9 | human | 2528 | FUT6 | fucosyltransferase 6 | NM_000150.2 | 89.9% | 84.2% | (many diffs) |
10 | human | 2528 | FUT6 | fucosyltransferase 6 | NM_001040701.1 | 89.9% | 84.2% | (many diffs) |
11 | human | 2528 | FUT6 | fucosyltransferase 6 | NM_001369502.1 | 89.9% | 84.2% | (many diffs) |
12 | human | 2528 | FUT6 | fucosyltransferase 6 | NM_001369504.1 | 89.9% | 84.2% | (many diffs) |
13 | human | 2528 | FUT6 | fucosyltransferase 6 | NM_001369505.1 | 89.9% | 84.2% | (many diffs) |
14 | human | 2528 | FUT6 | fucosyltransferase 6 | XM_011527872.3 | 89.9% | 84.2% | (many diffs) |
15 | human | 2528 | FUT6 | fucosyltransferase 6 | XM_011527875.3 | 89.9% | 84.2% | (many diffs) |
16 | human | 2528 | FUT6 | fucosyltransferase 6 | XM_011527879.3 | 89.9% | 84.2% | (many diffs) |
17 | human | 2528 | FUT6 | fucosyltransferase 6 | XM_005259527.4 | 87.5% | 81.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1152
- ORF length:
- 1083
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggatcccctg ggtgcagcca agccacaatg gccatggcgc cgctgtctgg 121 ccgcactgct atttcagctg ctggtggctg tgtgtttctt ctcctacctg cgtgtgtccc 181 gagacgatgc cactggatcc cctagggctc ccagtgggtc ctcccgacag gacaccactc 241 ccacccgccc caccctcctg atcctgctat ggacatggcc tttccacatc cctgtggctc 301 tgtcccgctg ttcagagatg gtgcccggca cagccgactg ccacatcact gccgaccgca 361 aggtgtaccc acaggcagac acggtcatcg tgcaccactg ggatatcatg tccaacccta 421 agtcacgcct cccaccttcc ccgaggccgc aggggcagcg ctggatctgg ttcaacttgg 481 agccaccccc taactgccag cacctggaag ccctggacag atacttcaat ctcaccatgt 541 cctaccgcag cgactccgac atcttcacgc cctacggctg gctggagccg tggtccggcc 601 agcctgccca cccaccgctc aacctctcgg ccaagaccga gctggtggcc tgggcggtgt 661 ccaactggaa gccggactca gccagggtgc gctactacca gagcctgcag gctcatctca 721 aggtggacgt gtacggacgc tcccacaagc ccctgcccaa ggggaccatg atggagacgc 781 tgtcccggta caagttctac ctggccttcg agaactcctt gcaccccgac tacaTCACCG 841 AGAAGCTGTG GAGGAACGCC CTGGAGGCCT GGGCCGTGCC CGTGGTGCTG GGCCCCAGCA 901 GAAGCAACTA CGAGAGGTTC CTGCCACCCG ACGCCTTCAT CCACGTGGAC GACTTCCAGA 961 GCCCCAAGGA CCTGGCCCGG TACCTGCAGG AGCTGGACAA GGACCACGCC CGCTACCTGA 1021 GCTACTTTCG CTGGCGGGAG ACGCTGCGGC CTCGCTCCTT CAGCTGGGCA CTGGATTTCT 1081 GCAAGGCCTG CTGGAAACTG CAGCAGGAAT CCAGGTACCA GACGGTGCGC AGCATAGCGG 1141 CTTGGTTCAC CTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1201 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1261 CGATTTCTTG GGCTTTATAT ATCTTGTGGA AAGGACGACA ACCCTACGTT ACGTTATCCT 1321 GAACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt