Construct: ORF TRCN0000476287
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015173.1_s317c1
- Derived from:
- ccsbBroadEn_06059
- DNA Barcode:
- TCAGTTGTACACACGCTATTCCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CSRP1 (1465)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476287
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1465 | CSRP1 | cysteine and glycine rich p... | NM_001193571.1 | 99.8% | 99.4% | 209G>T |
2 | human | 1465 | CSRP1 | cysteine and glycine rich p... | NM_001193572.1 | 99.8% | 99.4% | 209G>T |
3 | human | 1465 | CSRP1 | cysteine and glycine rich p... | NM_004078.3 | 99.8% | 99.4% | 209G>T |
4 | human | 1465 | CSRP1 | cysteine and glycine rich p... | NM_001193570.2 | 96.7% | 96.3% | 209G>T;389_390insGAAGGTGATTGGTGCTGG |
5 | mouse | 13007 | Csrp1 | cysteine and glycine-rich p... | NM_007791.5 | 90.6% | 98.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 645
- ORF length:
- 579
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gaactgggga ggaggcaaga aatgtggggt gtgtcagaag acggtttact 121 ttgccgaaga ggttcagtgc gaaggcaaca gcttccataa atcctgcttc ctgtgcatgg 181 tctgcaagaa gaatctggac agtaccactg tggccgtgca tggtgaggag atttactgca 241 agtcctgcta cggcaagaag tatgggccca aagtctatgg ctacgggcag ggcgcaggca 301 ccctcagcac tgacaagggg gagtcgctgg gtatcaagca cgaggaagcc cctggccaca 361 ggcccaccac caaccccaat gcatccaaat ttgcccagaa gattggtggc tCCGAGCGCT 421 GCCCCCGATG CAGCCAGGCA GTCTATGCTG CGGAGAAGGT GATTGGTGCT GGGAAGTCCT 481 GGCATAAGGC CTGCTTTCGA TGTGCCAAGT GTGGCAAAGG CCTTGAGTCA ACCACCCTGG 541 CAGACAAGGA TGGCGAGATT TACTGCAAAG GATGTTATGC TAAAAACTTC GGGCCCAAGG 601 GCTTTGGTTT TGGGCAAGGA GCTGGGGCCT TGGTCCACTC TGAGTGCCCA ACTTTCTTGT 661 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 721 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 781 GAAAGGACGA TCAGTTGTAC ACACGCTATT CCTCACGCGT TAAGTCgaca atcaacctct 841 ggattacaaa atttgtgaaa gatt