Construct: ORF TRCN0000476447
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012925.1_s317c1
- Derived from:
- ccsbBroadEn_01522
- DNA Barcode:
- ATTTCAAGTCCCCTCAGAGTCCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SRSF3 (6428)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476447
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6428 | SRSF3 | serine and arginine rich sp... | NM_003017.5 | 100% | 100% | |
| 2 | human | 6428 | SRSF3 | serine and arginine rich sp... | NR_036610.1 | 13.6% | 1_171del;513_968del;1120_3600del | |
| 3 | mouse | 20383 | Srsf3 | serine/arginine-rich splici... | NM_013663.5 | 91.8% | 100% | (many diffs) |
| 4 | mouse | 20383 | Srsf3 | serine/arginine-rich splici... | NR_036613.1 | 14.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 558
- ORF length:
- 492
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca tcgtgattcc tgtccattgg actgtaaggt ttatgtaggc aatcttggaa 121 acaatggcaa caagacggaa ttggaacggg cttttggcta ctatggacca ctccgaagtg 181 tgtgggttgc tagaaaccca cccggctttg cttttgttga atttgaagat ccccgagatg 241 cagctgatgc agtccgagag ctagatggaa gaacactatg tggctgccgt gtaagagtgg 301 aactgtcgaa tggtgaaaaa agaagtagaa atcgtggccc acctccctct tGGGGTCGTC 361 GCCCTCGAGA TGATTATCGT AGGAGGAGTC CTCCACCTCG TCGCAGATCT CCAAGAAGGA 421 GAAGCTTCTC TCGCAGCCGG AGCAGGTCCC TTTCTAGAGA TAGGAGAAGA GAGAGATCGC 481 TGTCTCGGGA GAGAAATCAC AAGCCGTCCC GATCCTTCTC TAGGTCTCGT AGTCGATCTA 541 GGTCAAATGA AAGGAAATAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 601 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 661 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAATTTCAA GTCCCCTCAG 721 AGTCCCGACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt