Construct: ORF TRCN0000476556
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017898.1_s317c1
- Derived from:
- ccsbBroadEn_05548
- DNA Barcode:
- GAGGGACGTCTAATACCATTGCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NRROS (375387)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476556
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 375387 | NRROS | negative regulator of react... | NM_198565.3 | 99.9% | 100% | 333C>A;450C>G |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2145
- ORF length:
- 2076
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagttgctg cctctttggc tctgcctggg ttttcacttc ctgaccgtgg 121 gctggaggaa cagaagcgga acagccacag cagcctccca aggagtctgc aagttggtgg 181 gtggagccgc tgactgccga gggcagagcc tcgcttcggt gcccagcagc ctcccgcccc 241 acgcccggat gctcaccctg gatgccaacc ctctcaagac cctgtggaat cactccctcc 301 agccttaccc tctcctggag agcctcagcc tgcacagctg ccacctggag cgcatcagcc 361 gcggcgcctt ccaggagcaa ggtcacctgc gcagcctggt actgggggac aactgcctct 421 cagagaacta cgaagagacg gcagccgccc tccacgccct gccgggcctg cggaggctgg 481 acttgtcagg aaacgccctg acggaggaca tggcagcgct catgctccag aacctctcct 541 cgctgcggtc cgtgtccctg gcggggaaca ccatcatgcg gctggacgac tccgtcttcg 601 agggcctgga gcgtctccgg gagctggatc tgcagaggaa ctacatcttc gagatcgagg 661 gcggcgcttt cgacggcctg gctgagctga ggcacctcaa cctggccttc aacaacctcc 721 cctgcatcgt ggacttcggg ctcacgcggc tgcgggtcct caacgtcagc tacaacgtcc 781 tggagtggtt cctcgcgacc gggggagagg ctgccttcga gctggagacg ctggacctgt 841 ctcacaacca gctgctgttc ttcccgctgc tgccccagta cagcaagttg cggaccctcc 901 tgctgcgcga caacaacatg ggcttctacc gggacctgta caacacctcg tcgccgaggg 961 agatggtggc ccagttcctc ctcgtggacg gcaacgtgac caacatcacc accgtcagcc 1021 tctgggaaga attctcctcc agcgacctcg cagatctccg cttcctggac atgagccaga 1081 accagttcca gtacctgcca gacggcttcc tgaggaaaat gccttccctc tcccacctga 1141 acctccacca gaattgcctg atgacgcttc acattcggga gcacgagccc cccggagcgc 1201 tcaccgagct ggacctgagc cacaaccagc tgtcggagct gcacctggct ccggggctgg 1261 ccagctgcct gggcagcctg cgcttgttca acctgagctc caaccagctc ctgggcgtcc 1321 cccctggcct cttcgccaat gctaggaaca tcactacact tgacatgagc cacaatcaga 1381 tctcactttg tcccctgcca gctgcctcgg accgggtggg cccccctagc tgtgtggatt 1441 tcaggaatat ggcatcttta aggagcctgt ctctggaggg ctgtggcctg ggggcattgc 1501 cagactgccc attccaaggg acctccctga cctacttaga cctctcaagc aactgggggg 1561 ttctgaatgg gagcctcgcc ccactccagg atgttgcccc catgttacag gtcctgtctc 1621 tcaggaacat gggcctccac tccagcttta tggcgttgga cttctctggg tttgggaatc 1681 tcagggactt agatctgtcg gggaattgct tgaccacctt cccaaggttt gggggcagcc 1741 tggccctgga gaccctggat ctccgtagaa actcgctcac agcccttccc cagaaggctg 1801 tgtctgagca gctctcgaga ggtctgcgga ccatctacct cagtcagaat ccatatgact 1861 gctgtggggt ggatggctgg ggggcccTGC AGCATGGGCA GACGGTGGCC GACTGGGCCA 1921 TGGTCACCTG CAACCTCTCC TCCAAGATCA TCCGCGTGAC GGAGCTGCCC GGAGGTGTGC 1981 CTCGGGACTG CAAGTGGGAG CGGCTGGACC TGGGCCTGCT CTACCTCGTG CTCATCCTCC 2041 CCAGCTGCCT CACCCTGCTG GTGGCCTGCA CTGTCATCGT CCTCACTTTT AAGAAGCCTC 2101 TGCTTCAGGT CATCAAGAGC CGCTGCCACT GGTCCTCCGT TTACTTGCCA ACTTTCTTGT 2161 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 2221 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 2281 GAAAGGACGA GAGGGACGTC TAATACCATT GCATACGCGT TAAGTCgaca atcaacctct 2341 ggattacaaa atttgtgaaa gatt