Construct: ORF TRCN0000476606
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015742.1_s317c1
- Derived from:
- ccsbBroadEn_03158
- DNA Barcode:
- AAATCCTAGGCTATCCATTGGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CLEC4A (50856)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476606
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 50856 | CLEC4A | C-type lectin domain family... | NM_016184.3 | 100% | 100% | |
| 2 | human | 50856 | CLEC4A | C-type lectin domain family... | NM_194450.2 | 86% | 85.6% | 199_200ins99 |
| 3 | human | 50856 | CLEC4A | C-type lectin domain family... | NM_194447.2 | 83.5% | 83.1% | 82_83ins117 |
| 4 | human | 50856 | CLEC4A | C-type lectin domain family... | XM_011520684.2 | 79.3% | 75.5% | (many diffs) |
| 5 | human | 50856 | CLEC4A | C-type lectin domain family... | NM_194448.2 | 69.6% | 69.6% | 80_81ins216 |
| 6 | human | 50856 | CLEC4A | C-type lectin domain family... | XM_017019382.2 | 59.9% | 59.9% | 0_1ins285 |
| 7 | human | 50856 | CLEC4A | C-type lectin domain family... | XM_024448997.1 | 59.9% | 59.9% | 0_1ins285 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 780
- ORF length:
- 711
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacttcggaa atcacttatg ctgaagtgag gttcaaaaat gaattcaagt 121 cctcaggcat caacacagcc tcttctgcag cttccaagga gaggactgcc cctcacaaaa 181 gtaataccgg attccccaag ctgctttgtg cctcactgtt gatatttttc ctgctattgg 241 caatctcatt ctttattgct tttgtcattt tctttcaaaa atattctcag cttcttgaaa 301 aaaagactac aaaagagctg gttcatacaa cattggagtg tgtgaaaaaa aatatgcccg 361 tggaagagac agcctggagc tgttgcccaa agaattggaa gtcatttagt tccaactgct 421 actttatttc tactgaatca gcatcttGGC AAGACAGTGA GAAGGACTGT GCTAGAATGG 481 AGGCTCACCT GCTGGTGATA AACACTCAAG AAGAGCAGGA TTTCATCTTC CAGAATCTGC 541 AAGAAGAATC TGCTTATTTT GTGGGGCTCT CAGATCCAGA AGGTCAGCGA CATTGGCAAT 601 GGGTTGATCA GACACCATAC AATGAAAGTT CCACATTCTG GCATCCACGT GAGCCCAGTG 661 ATCCCAATGA GCGCTGCGTT GTGCTAAATT TTCGTAAATC ACCCAAAAGA TGGGGCTGGA 721 ATGATGTTAA TTGTCTTGGT CCTCAAAGGT CAGTTTGTGA GATGATGAAG ATCCACTTAT 781 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 841 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 901 TTTATATATC TTGTGGAAAG GACGAAAATC CTAGGCTATC CATTGGTCAA CGCGTTAAGT 961 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt