Construct: ORF TRCN0000476953
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012307.1_s317c1
- Derived from:
- ccsbBroadEn_10174
- DNA Barcode:
- TTACATCAGCCGAACTGCCCCATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- H2AB2 (474381)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476953
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 474381 | H2AB2 | H2A.B variant histone 2 | NM_001017991.2 | 99.7% | 100% | 135T>C |
| 2 | human | 83740 | H2AB3 | H2A.B variant histone 3 | NM_080720.1 | 99.7% | 100% | 135T>C |
| 3 | human | 474382 | H2AB1 | H2A.B variant histone 1 | NM_001017990.1 | 99.4% | 99.1% | 135T>C;203C>T |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 414
- ORF length:
- 345
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccgaggagg aggagacgcc gagggtcctc cggtgctggc ggccgggggc 121 ggacctgctc tcgcaccgtc cgagcggagc tttcgttttc agtgagccag gtggagcgca 181 gtctacggga gggccactac gcccagcgcc tgagtcgcac ggcgccggtc tacctcgctg 241 cggttattga gtacctgacg gccaaggtcc tGGAGCTGGC GGGCAACGAG GCCCAGAACA 301 GCGGAGAGCG GAACATCACT CCCCTGCTGC TGGACATGGT GGTTCACAAC GACAGGCTAC 361 TGAGCACCCT TTTCAACACG ACCACCATCT CTCAAGTGGC CCCTGGCGAG GACTTGCCAA 421 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 481 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 541 TATCTTGTGG AAAGGACGAT TACATCAGCC GAACTGCCCC ATGACGCGTT AAGTCgacaa 601 tcaacctctg gattacaaaa tttgtgaaag att