Construct: ORF TRCN0000477781
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013040.1_s317c1
- Derived from:
- ccsbBroadEn_09711
- DNA Barcode:
- AACCTGCTAGCGGTTCTAGGCCGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LINC01600 (154386)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477781
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 154386 | LINC01600 | long intergenic non-protein... | NR_131168.1 | 15.6% | 1_524del;761C>T;906_2434del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 450
- ORF length:
- 381
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gatctatcca cttgacctct tcaggaacat tccctggaag caggggaagt 121 gctttgcttc cctgtctccc gagggagaaa gggcatttga tggcatggag ccactctgcc 181 agccaggagc caggcccgct ctaagggggc tacagcatgc ctcagattgc tacaggctcc 241 tctcccctcc cgggtccggc cttgtcggca ccaacccctc agttcctgcc ccatctcccc 301 actgtggttg ctgtcaggcc tggagcattt cctccttcac tttcacgggt cccacaccct 361 tcaagatcaa cagtgaccag gccactccct gccatcTGAG AAGCCCAGAA ACCATCTTCC 421 GTCAGAGGGA GATTAGCAAT GAAGCTTTCT TGCCAACTTT CTTGTACAAA GTGGTTGATA 481 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 541 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAAACCT 601 GCTAGCGGTT CTAGGCCGAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 661 tgaaagatt