Construct: ORF TRCN0000478399
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015735.1_s317c1
- Derived from:
- ccsbBroadEn_04682
- DNA Barcode:
- GCTAAACCTGGCCCAAGAGGCGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MALSU1 (115416)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478399
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 115416 | MALSU1 | mitochondrial assembly of r... | NM_138446.2 | 100% | 100% | |
| 2 | human | 115416 | MALSU1 | mitochondrial assembly of r... | XM_017011731.1 | 59.4% | 59.4% | 0_1ins285 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 768
- ORF length:
- 702
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gccgggcggc cgtgtggcgc ggctgctcgc cccactaatg tggcgcaggg 121 cggtttcctc ggtggcgggg tccgcggttg gagccgagcc cgggcttcgg ctgctggccg 181 tgcagcggct tcccgtagga gcagcgttct gccgggcttg ccagacccca aactttgtcc 241 gcggcctgca cagcgagcct gggctggagg agcgggcgga ggggacggtc aacgagggac 301 gcccagaatc ggacgcggca gatcatactg gtcccaagtt tgacatcgat atgatggttt 361 cacttctgag gcaagaaaat gcaagagaca tttgtgtgat ccaggttcct ccagaaatga 421 gatatacaga ttactttgtg attgttagtg gaacttctac ccgacactta catgccatgg 481 ccTTCTACGT TGTGAAAATG TACAAACACC TGAAATGTAA ACGTGACCCT CATGTTAAGA 541 TAGAAGGGAA GGACACTGAT GACTGGCTGT GCGTGGATTT TGGCAGCATG GTGATTCATT 601 TGATGCTTCC AGAAACCAGA GAAATCTATG AATTAGAGAA ATTATGGACC CTACGTTCTT 661 ATGATGACCA GTTAGCTCAG ATAGCACCTG AGACAGTACC TGAAGACTTC ATTCTTGGAA 721 TAGAAGATGA TACTTCATCT GTGACTCCAG TGGAGTTAAA ATGTGAATAC CCAACTTTCT 781 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 841 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 901 GTGGAAAGGA CGAGCTAAAC CTGGCCCAAG AGGCGCGACG CGTTAAGTCg acaatcaacc 961 tctggattac aaaatttgtg aaagatt