Construct: ORF TRCN0000478635
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013357.1_s317c1
- Derived from:
- ccsbBroadEn_12490
- DNA Barcode:
- ATATACTTTCTAGGCATTCCACGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AEN (64782)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478635
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64782 | AEN | apoptosis enhancing nuclease | NM_022767.4 | 64.1% | 64% | 1_348del;418A>G;642G>C |
| 2 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_005254966.1 | 64.1% | 64% | 1_348del;418A>G;642G>C |
| 3 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_005254967.1 | 64.1% | 64% | 1_348del;418A>G;642G>C |
| 4 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_011521905.2 | 64.1% | 64% | 1_348del;418A>G;642G>C |
| 5 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_017022489.1 | 64.1% | 64% | 1_348del;418A>G;642G>C |
| 6 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_006720645.3 | 40.1% | 40% | (many diffs) |
| 7 | human | 64782 | AEN | apoptosis enhancing nuclease | XM_017022490.1 | 40.1% | 40% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 693
- ORF length:
- 627
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gggcacggga ccccgagggc gggtaagcga gctggcccgc tgttccattg 121 tgagctacca tggcgatgtc ctctatgaca agtacatcag gcctgagatg cccatcgctg 181 actaccgtac ccgctggagt ggcatcactc ggcagcacat gcgcaaggct gtccccttcc 241 aggtggccca gaaagagatc cttaagctcc tgaagggcaa ggtggtggtg gggcacgcgc 301 tgcacaacga cttccaggcg ctcaagtatg tccaccctcg gagccagacc cgggatacca 361 cctatgtccc aaacttccTC AGCGAGCCCG GCCTCCACAC CCGGGCCCGG GTCTCTCTAA 421 AGGACCTGGC CCTGCAGCTG CTGCACAAGA AGATCCAGGT GGGCCAGCAC GGGCACTCAT 481 CAGTAGAAGA TGCCACGACA GCCATGGAGC TCTACCGGCT GGTGGAGGTG CAGTGGGAAC 541 AGCAGGAGGC CCGCAGCCTC TGGACCTGCC CCGAGGACAG AGAACCTGAC AGCAGCACAG 601 ACATGGAACA GTACATGGAG GACCAGTACT GGCCCGATGA CCTGGCCCAC GGCAGCAGAG 661 GAGGAGCCAG GGAGGCACAG GACAGAAGGA ATTGCCCAAC TTTCTTGTAC AAAGTGGTTG 721 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 781 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAT 841 ATACTTTCTA GGCATTCCAC GCACGCGTTA AGTCgacaat caacctctgg attacaaaat 901 ttgtgaaaga tt