Construct: ORF TRCN0000479429
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017553.1_s317c1
- Derived from:
- ccsbBroadEn_05580
- DNA Barcode:
- CGGATTGTTCATCTCTTCATCCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCDC103 (388389)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479429
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 388389 | CCDC103 | coiled-coil domain containi... | NM_001258395.2 | 100% | 100% | |
2 | human | 388389 | CCDC103 | coiled-coil domain containi... | NM_001258396.2 | 100% | 100% | |
3 | human | 388389 | CCDC103 | coiled-coil domain containi... | NM_213607.3 | 100% | 100% | |
4 | human | 388389 | CCDC103 | coiled-coil domain containi... | NM_001258398.2 | 42.3% | 38.4% | 278delT;309_310ins418 |
5 | human | 388389 | CCDC103 | coiled-coil domain containi... | NM_001258399.2 | 42.1% | 38.5% | 276_279delGGTA;312_313ins418 |
6 | human | 388389 | CCDC103 | coiled-coil domain containi... | NM_001258397.1 | 38.8% | 38.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 792
- ORF length:
- 726
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga aaggaatgac atcatcaact tcaaggcttt ggagaaagag ctgcaggctg 121 cactcactgc tgatgagaag tacaaacggg agaatgctgc caagttacgg gcagtggaac 181 agagggtggc ttcctatgag gagttcaggg gtattgtcct tgcatcacat ctgaagccac 241 tggagcggaa ggataagatg ggaggaaaga gaactgtgcc ctggaactgt cacactattc 301 agggaaggac cttccaggat gtggccactg aaatctcccc ggagaaagcc cccctccagc 361 ccgagacgtc tgctgacttc tatcgtgatt ggcgacgaca cttgccaagt gggccagagc 421 gctaccaggc tctactgcag cttgggggtc caaggctcgg ctgcctcttc cagacagatg 481 tgggatttgg acttcttggg gagctgctgg tggcactggc tgatcacgtg gggccggctg 541 accgggcagc ggtgctgggg atCCTATGCA GCCTGGCGAG CACTGGGCGC TTCACCCTGA 601 ACCTAAGCCT GCTGAGCCGG GCAGAGAGAG AGAGCTGCAA GGGCTTGTTT CAGAAGCTGC 661 AAGCCATGGG CAACCCCAGA TCCGTGAAGG AGGGGCTCAG CTGGGAGGAG CAGGGTCTGG 721 AGGAGCAGTC TGGTGGGCTC CAGGAGGAGG AGAGGCTCCT GCAGGAGCTG CTGGAGCTGT 781 ACCAGGTTGA CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 841 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 901 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACGG ATTGTTCATC TCTTCATCCA 961 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t