Construct: ORF TRCN0000479498
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003342.1_s317c1
- Derived from:
- ccsbBroadEn_09495
- DNA Barcode:
- TCAGTGTGATGGGCTGCCTGCCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SWSAP1 (126074)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479498
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 126074 | SWSAP1 | SWIM-type zinc finger 7 ass... | NM_175871.4 | 91.3% | 91.2% | 1_63del;326C>T;525C>T |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 756
- ORF length:
- 687
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcctgccgcc ggaccgcctt tgctgctgct cggtacacca ggatctggaa 121 aaacagcgct gctatttgct gcggccctag aggcggcggg ggagggccaa ggcccagtcc 181 tcttcctgac acgaaggcct cttcaaagca tgccccgcgg gaccggaacg actctagacc 241 caatgcgact ccagaagatc cgcttccagt acccaccctc aacccgagag cttttccggc 301 tcctgtgctc tgcccatgag gccccggggc tagccccctc ccttctgctg ctcgacggcc 361 tagaagagta cctagcggaa gacccagagc cccaggaagc cgcctacctc attgccttac 421 ttctagacac agctgcccac ttcagccacc ggcttgggcc tggccgggat tgtgggctca 481 tggtggCCCT CCAGACCCAG GAGGAAGCAG GTAGTGGGGA CGTCCTGCAT CTGGCACTGC 541 TCCAGCGGTA TTTTCCTGCC CAGTGCTGGC TGCAGCCAGA TGCACCAGGT CCAGGAGAGC 601 ACGGCCTCCG AGCCTGCCTG GAGCCAGGCG GGCTGGGCCC CAGAACAGAG TGGTGGGTGA 661 CTTTCCGATC AGATGGAGAA ATGATGATCG CTCCGTGGCC CACCCAGGCT GGTGACCCCA 721 GCTCAGGCAA GGGTTCAAGC TCTGGAGGCC AGCCCTTGCC AACTTTCTTG TACAAAGTGG 781 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 841 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 901 ATCAGTGTGA TGGGCTGCCT GCCTCACGCG TTAAGTCgac aatcaacctc tggattacaa 961 aatttgtgaa agatt