Construct: ORF TRCN0000479539
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012433.2_s317c1
- Derived from:
- ccsbBroadEn_00939
- DNA Barcode:
- CATACATACGGTAATGAGGCCGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LGALS4 (3960)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479539
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3960 | LGALS4 | galectin 4 | NM_006149.4 | 100% | 100% | |
| 2 | human | 3960 | LGALS4 | galectin 4 | XM_011526973.2 | 95.9% | 95.9% | 501_502ins39 |
| 3 | human | 3960 | LGALS4 | galectin 4 | XM_011526974.2 | 59.4% | 59.4% | 0_1ins393 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1035
- ORF length:
- 969
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctatgtcccc gcaccgggct accagcccac ctacaacccg acgctgcctt 121 actaccagcc catcccgggc gggctcaacg tgggaatgtc tgtttacatc caaggagtgg 181 ccagcgagca catgaagcgg ttcttcgtga actttgtggt tgggcaggat ccgggctcag 241 acgtcgcctt ccacttcaat ccgcggtttg acggctggga caaggtggtc ttcaacacgt 301 tgcagggcgg gaagtggggc agcgaggaga ggaagaggag catgcccttc aaaaagggtg 361 ccgcctttga gctggtcttc atagtcctgg ctgagcacta caaggtggtg gtaaatggaa 421 atcccttcta tgagtacggg caccggcttc ccctacagat ggtcacccac ctgcaagtgg 481 atggggatct gcaacttcaa tcaatcaact tcatcggagg ccagcccctc cggccccagg 541 gacccccgat gatgccacct taccctggtc ccggacattg ccatcaacag ctgaacagcc 601 tgcccaccat ggaaggaccc ccaaccttca acccgcctgt gccatatttc gggaggctgc 661 aaggagggct cacagctcga agaaccatca tcatcaaggg ctatgtgccT CCCACAGGCA 721 AGAGCTTTGC TATCAACTTC AAGGTGGGCT CCTCAGGGGA CATAGCTCTG CACATTAATC 781 CCCGCATGGG CAACGGTACC GTGGTCCGGA ACAGCCTTCT GAATGGCTCG TGGGGATCCG 841 AGGAGAAGAA GATCACCCAC AACCCATTTG GTCCCGGACA GTTCTTTGAT CTGTCCATTC 901 GCTGTGGCTT GGATCGCTTC AAGGTTTACG CCAATGGCCA GCACCTCTTT GACTTTGCCC 961 ATCGCCTCTC GGCCTTCCAG AGGGTGGACA CATTGGAAAT CCAGGGTGAT GTCACCTTGT 1021 CCTATGTCCA GATCTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1081 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1141 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CATACATACG GTAATGAGGC 1201 CGAAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt